BMRB Entry 6320
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6320
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 1H, 13C, 15N chemical shift assignments for extended 3' internal stem-loop RNA from S. cerevisiae U6 snRNA PubMed: 15543154
Deposition date: 2004-09-21 Original release date: 2004-11-16
Authors: Sashital, Dipali; Cornilescu, Gabriel; Butcher, Samuel
Citation: Sashital, Dipali; Cornilescu, Gabriel; McManus, C.; Brow, D.; Butcher, Samuel. "U2-U6 RNA folding reveals a group II intron-like domain and a four-helix junction" Nat. Struct. Mol. Biol. 11, 1237-1242 (2004).
Assembly members:
U6 extended ISL, polymer, 32 residues, Formula weight is not available
Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
U6 extended ISL: GAGCAGUUCCCCUGCAUAAG
GAUGAACCGUUC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 189 |
15N chemical shifts | 14 |
1H chemical shifts | 272 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | U6 extended ISL | 1 |
Entities:
Entity 1, U6 extended ISL 32 residues - Formula weight is not available
1 | G | A | G | C | A | G | U | U | C | C | ||||
2 | C | C | U | G | C | A | U | A | A | G | ||||
3 | G | A | U | G | A | A | C | C | G | U | ||||
4 | U | C |
Samples:
sample_1: U6 extended ISL, [U-13C; U-15N], 1 mM
sample_conditions_1: pH: 6.9; temperature: 283 K
sample_conditions_2: pH: 7.5; temperature: 303 K
sample_conditions_3: pH: 6.9; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | sample_1 | not available | not available |
2D TOCSY | sample_1 | not available | not available |
3D [1H-13C-1H] NOESY HMQC | sample_1 | not available | not available |
3D [1H-13C-1H] HCCH-TOCSY | sample_1 | not available | not available |
3D [1H-13C-1H] HCCH-COSY | sample_1 | not available | not available |
J-Modulated CT-HSQC | sample_1 | not available | not available |
Software:
SPARKY v3.105 -
NMR spectrometers:
- Bruker DMX 600 MHz
- Varian Inova 600 MHz
- Bruker DMX 750 MHz
- Varian Inova 800 MHz