BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6477

Title: Solution structure of the P2b-P3 pseudoknot from human telomerase RNA   PubMed: 15749017

Deposition date: 2005-02-02 Original release date: 2006-02-17

Authors: Theimer, C.; Blois, C.; Feigon, J.

Citation: Theimer, C.; Blois, C.; Feigon, J.. "Structure of the human telomerase RNA pseudoknot reveals conserved tertiary interactions essential for function."  Mol. Cell 17, 671-682 (2005).

Assembly members:
Telomerase RNA P2b-P3 pseudoknot, polymer, 47 residues, Formula weight is not available

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: enzymatic semi-synthesis

Entity Sequences (FASTA):
Telomerase RNA P2b-P3 pseudoknot: GGGCUGUUUUUCUCGCUGAC UUUCAGCCCCAAACAAAAAA GUCAGCA

Data sets:
Data typeCount
13C chemical shifts273
15N chemical shifts73
1H chemical shifts336

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Telomerase RNA P2b-P3 pseudoknot1

Entities:

Entity 1, Telomerase RNA P2b-P3 pseudoknot 47 residues - Formula weight is not available

1   GGGCUGUUUU
2   UCUCGCUGAC
3   UUUCAGCCCC
4   AAACAAAAAA
5   GUCAGCA

Samples:

sample_1: Telomerase RNA P2b-P3 pseudoknot 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_2: Telomerase RNA P2b-P3 pseudoknot 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_3: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N], 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_4: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N], 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_5: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-A, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_6: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-A, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_7: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-C, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_8: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-C, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_9: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-G, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_10: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-G, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_11: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-U, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_12: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-U, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_cond_1: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K

sample_cond_2: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D NOESY (11echo and watergate)not availablenot availablenot available
2D NOESYnot availablenot availablenot available
2D TOCSY (presat)not availablenot availablenot available
2D 15N-HMQCnot availablenot availablenot available
2D 15N-CPMG-NOESYnot availablenot availablenot available
2D JNN-HNN-COSYnot availablenot availablenot available
2D 13C-HSQCnot availablenot availablenot available
2D HCCH COSYnot availablenot availablenot available
3D HCCH-TOCSYnot availablenot availablenot available
2D 13C filtered/edited NOESYsnot availablenot availablenot available

Software:

xwinnmr v2.6 - collection, processing

AURELIA v3.108 - data analysis

X-PLOR NIH v1.0.6 - refinement, structure solution

NMR spectrometers:

  • Bruker AVANCE 800 MHz