BMRB Entry 19594
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19594
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3 PubMed: 24356977
Deposition date: 2013-11-01 Original release date: 2014-01-21
Authors: Chung, Wan Jun; Heddi, Brahim; Hamon, Florian; Teulade-Fichou, Marie-Paule; Phan, Anh Tuan
Citation: Chung, Wan Jun; Heddi, Brahim; Hamon, Florian; Teulade-Fichou, Marie-Paule; Phan, Anh Tuan. "Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3." Angew. Chem. Int. Ed. Engl. 53, 999-1002 (2014).
Assembly members:
DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*G)-3'), polymer, 24 residues, 7691.996 Da.
entity_PQ3, non-polymer, 550.609 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*G)-3'): TGAGGGTGGTGAGGGTGGGG
AAGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 194 |