data_17559 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 17559 _Entry.Title ; Assignment of the stem loop 2 of RsmZ ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2011-03-31 _Entry.Accession_date 2011-03-31 _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Mario Schubert . . . 17559 2 Thomas Aeschbacher . H. . 17559 3 Olivier Duss . . . 17559 4 Frederic Allain . HT . 17559 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 17559 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 59 17559 '1H chemical shifts' 59 17559 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2012-03-08 2011-03-31 update BMRB 'update entry citation' 17559 1 . . 2012-01-24 2011-03-31 original author 'original release' 17559 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 17326 '20 nt RNA stem loop' 17559 BMRB 17560 'Assignment of the stem loop 4 of RsmZ' 17559 BMRB 17566 '22 nt artificial stemloop TASL1' 17559 BMRB 17567 '26 nt artificial stemloop TASL2' 17559 BMRB 17568 '30 nt artificial stemloop TASL2' 17559 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 17559 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 22252483 _Citation.Full_citation . _Citation.Title 'A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Biomol. NMR' _Citation.Journal_name_full 'Journal of biomolecular NMR' _Citation.Journal_volume 52 _Citation.Journal_issue 2 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 179 _Citation.Page_last 190 _Citation.Year 2012 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Thomas Aeschbacher . . . 17559 1 2 Mario Schubert . . . 17559 1 3 'Frederic H-T' Allain . . . 17559 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 17559 _Assembly.ID 1 _Assembly.Name 'FZL2 (monomer)' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'FZL2 (monomer)' 1 $FZL2 A . yes native no no . . . 17559 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_FZL2 _Entity.Sf_category entity _Entity.Sf_framecode FZL2 _Entity.Entry_ID 17559 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name FZL2 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGCCAUCAAGGACGAUGGU CC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not reported' _Entity.Src_method . _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 17559 1 2 . G . 17559 1 3 . G . 17559 1 4 . C . 17559 1 5 . C . 17559 1 6 . A . 17559 1 7 . U . 17559 1 8 . C . 17559 1 9 . A . 17559 1 10 . A . 17559 1 11 . G . 17559 1 12 . G . 17559 1 13 . A . 17559 1 14 . C . 17559 1 15 . G . 17559 1 16 . A . 17559 1 17 . U . 17559 1 18 . G . 17559 1 19 . G . 17559 1 20 . U . 17559 1 21 . C . 17559 1 22 . C . 17559 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 17559 1 . G 2 2 17559 1 . G 3 3 17559 1 . C 4 4 17559 1 . C 5 5 17559 1 . A 6 6 17559 1 . U 7 7 17559 1 . C 8 8 17559 1 . A 9 9 17559 1 . A 10 10 17559 1 . G 11 11 17559 1 . G 12 12 17559 1 . A 13 13 17559 1 . C 14 14 17559 1 . G 15 15 17559 1 . A 16 16 17559 1 . U 17 17 17559 1 . G 18 18 17559 1 . G 19 19 17559 1 . U 20 20 17559 1 . C 21 21 17559 1 . C 22 22 17559 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 17559 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $FZL2 . 294 organism . 'Pseudomonas fluorescens' g-proteobacteria . . Bacteria . Pseudomonas fluorescens . . . . . . . . . . . . . . . . . . . . . 17559 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 17559 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $FZL2 . 'cell free synthesis' 'not applicable' . . . not applicable . . . . . . . . . . . . . 'not applicable' . . 'not applicable' . . . ; Production method should be: "in vitro transcription" using a chemically synthetized DNA template (cell free synthesis is not really correct) ; . . 17559 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 17559 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 FZL2 'natural abundance' . . 1 $FZL2 . . 2 . . mM . . . . 17559 1 2 D2O 'natural abundance' . . . . . . 100 . . % . . . . 17559 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 17559 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '95% H2O/5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 FZL2 'natural abundance' . . 1 $FZL2 . . 2 . . mM . . . . 17559 2 2 D2O 'natural abundance' . . . . . . 5 . . % . . . . 17559 2 3 H2O 'natural abundance' . . . . . . 95 . . % . . . . 17559 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 17559 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0 . M 17559 1 pH 7.4 . pH 17559 1 pressure 1 . atm 17559 1 temperature 303 . K 17559 1 stop_ save_ ############################ # Computer software used # ############################ save_TOPSPIN _Software.Sf_category software _Software.Sf_framecode TOPSPIN _Software.Entry_ID 17559 _Software.ID 1 _Software.Name TOPSPIN _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 17559 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID collection 17559 1 refinement 17559 1 stop_ save_ save_SPARKY _Software.Sf_category software _Software.Sf_framecode SPARKY _Software.Entry_ID 17559 _Software.ID 2 _Software.Name SPARKY _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 17559 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 17559 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 17559 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 500 save_ save_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_2 _NMR_spectrometer.Entry_ID 17559 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_spectrometer_3 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_3 _NMR_spectrometer.Entry_ID 17559 _NMR_spectrometer.ID 3 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 900 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 17559 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 500 . . . 17559 1 2 spectrometer_2 Bruker Avance . 600 . . . 17559 1 3 spectrometer_3 Bruker Avance . 900 . . . 17559 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 17559 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 17559 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 17559 1 3 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 17559 1 4 '2D 1H-13C HSQC' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 17559 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 17559 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.00 . indirect 0.251449530 . . . . . . . . . 17559 1 H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . . . . . 17559 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 17559 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 17559 1 2 '2D 1H-1H NOESY' . . . 17559 1 3 '2D 1H-1H TOCSY' . . . 17559 1 4 '2D 1H-13C HSQC' . . . 17559 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.786 0.004 . 1 . . . . 1 G H1' . 17559 1 2 . 1 1 1 1 G H8 H 1 8.155 0.005 . 1 . . . . 1 G H8 . 17559 1 3 . 1 1 1 1 G C1' C 13 90.739 0.050 . 1 . . . . 1 G C1' . 17559 1 4 . 1 1 1 1 G C8 C 13 139.212 0.050 . 1 . . . . 1 G C8 . 17559 1 5 . 1 1 2 2 G H1' H 1 5.934 0.003 . 1 . . . . 2 G H1' . 17559 1 6 . 1 1 2 2 G H8 H 1 7.657 0.005 . 1 . . . . 2 G H8 . 17559 1 7 . 1 1 2 2 G C1' C 13 92.357 0.050 . 1 . . . . 2 G C1' . 17559 1 8 . 1 1 2 2 G C8 C 13 137.127 0.050 . 1 . . . . 2 G C8 . 17559 1 9 . 1 1 3 3 G H1' H 1 5.808 0.002 . 1 . . . . 3 G H1' . 17559 1 10 . 1 1 3 3 G H8 H 1 7.289 0.007 . 1 . . . . 3 G H8 . 17559 1 11 . 1 1 3 3 G C1' C 13 93.419 0.050 . 1 . . . . 3 G C1' . 17559 1 12 . 1 1 3 3 G C8 C 13 136.822 0.050 . 1 . . . . 3 G C8 . 17559 1 13 . 1 1 4 4 C H1' H 1 5.521 0.002 . 1 . . . . 4 C H1' . 17559 1 14 . 1 1 4 4 C H5 H 1 5.348 0.002 . 1 . . . . 4 C H5 . 17559 1 15 . 1 1 4 4 C H6 H 1 7.672 0.002 . 1 . . . . 4 C H6 . 17559 1 16 . 1 1 4 4 C C1' C 13 93.843 0.050 . 1 . . . . 4 C C1' . 17559 1 17 . 1 1 4 4 C C5 C 13 97.400 0.050 . 1 . . . . 4 C C5 . 17559 1 18 . 1 1 4 4 C C6 C 13 140.546 0.050 . 1 . . . . 4 C C6 . 17559 1 19 . 1 1 5 5 C H1' H 1 5.458 0.003 . 1 . . . . 5 C H1' . 17559 1 20 . 1 1 5 5 C H5 H 1 5.532 0.002 . 1 . . . . 5 C H5 . 17559 1 21 . 1 1 5 5 C H6 H 1 7.728 0.004 . 1 . . . . 5 C H6 . 17559 1 22 . 1 1 5 5 C C1' C 13 93.950 0.050 . 1 . . . . 5 C C1' . 17559 1 23 . 1 1 5 5 C C5 C 13 98.113 0.050 . 1 . . . . 5 C C5 . 17559 1 24 . 1 1 5 5 C C6 C 13 140.954 0.050 . 1 . . . . 5 C C6 . 17559 1 25 . 1 1 6 6 A H1' H 1 5.901 0.003 . 1 . . . . 6 A H1' . 17559 1 26 . 1 1 6 6 A H2 H 1 7.303 0.002 . 1 . . . . 6 A H2 . 17559 1 27 . 1 1 6 6 A H8 H 1 8.062 0.005 . 1 . . . . 6 A H8 . 17559 1 28 . 1 1 6 6 A C1' C 13 93.151 0.050 . 1 . . . . 6 A C1' . 17559 1 29 . 1 1 6 6 A C2 C 13 153.190 0.050 . 1 . . . . 6 A C2 . 17559 1 30 . 1 1 6 6 A C8 C 13 139.736 0.050 . 1 . . . . 6 A C8 . 17559 1 31 . 1 1 7 7 U H1' H 1 5.462 0.002 . 1 . . . . 7 U H1' . 17559 1 32 . 1 1 7 7 U H5 H 1 4.967 0.004 . 1 . . . . 7 U H5 . 17559 1 33 . 1 1 7 7 U H6 H 1 7.633 0.004 . 1 . . . . 7 U H6 . 17559 1 34 . 1 1 7 7 U C1' C 13 93.275 0.050 . 1 . . . . 7 U C1' . 17559 1 35 . 1 1 7 7 U C5 C 13 102.615 0.050 . 1 . . . . 7 U C5 . 17559 1 36 . 1 1 7 7 U C6 C 13 141.523 0.050 . 1 . . . . 7 U C6 . 17559 1 37 . 1 1 8 8 C H1' H 1 5.495 0.002 . 1 . . . . 8 C H1' . 17559 1 38 . 1 1 8 8 C H5 H 1 5.419 0.003 . 1 . . . . 8 C H5 . 17559 1 39 . 1 1 8 8 C H6 H 1 7.624 0.001 . 1 . . . . 8 C H6 . 17559 1 40 . 1 1 8 8 C C1' C 13 93.707 0.050 . 1 . . . . 8 C C1' . 17559 1 41 . 1 1 8 8 C C5 C 13 97.630 0.050 . 1 . . . . 8 C C5 . 17559 1 42 . 1 1 8 8 C C6 C 13 141.180 0.050 . 1 . . . . 8 C C6 . 17559 1 43 . 1 1 9 9 A H1' H 1 5.641 0.001 . 1 . . . . 9 A H1' . 17559 1 44 . 1 1 9 9 A H2 H 1 6.955 0.001 . 1 . . . . 9 A H2 . 17559 1 45 . 1 1 9 9 A H8 H 1 7.855 0.001 . 1 . . . . 9 A H8 . 17559 1 46 . 1 1 9 9 A C1' C 13 92.727 0.050 . 1 . . . . 9 A C1' . 17559 1 47 . 1 1 9 9 A C2 C 13 153.570 0.050 . 1 . . . . 9 A C2 . 17559 1 48 . 1 1 9 9 A C8 C 13 139.728 0.050 . 1 . . . . 9 A C8 . 17559 1 49 . 1 1 10 10 A H1' H 1 5.498 0.003 . 1 . . . . 10 A H1' . 17559 1 50 . 1 1 10 10 A H2 H 1 7.905 0.001 . 1 . . . . 10 A H2 . 17559 1 51 . 1 1 10 10 A H8 H 1 7.794 0.002 . 1 . . . . 10 A H8 . 17559 1 52 . 1 1 10 10 A C1' C 13 91.522 0.050 . 1 . . . . 10 A C1' . 17559 1 53 . 1 1 10 10 A C2 C 13 155.299 0.050 . 1 . . . . 10 A C2 . 17559 1 54 . 1 1 10 10 A C8 C 13 139.954 0.050 . 1 . . . . 10 A C8 . 17559 1 55 . 1 1 11 11 G H1' H 1 5.141 0.004 . 1 . . . . 11 G H1' . 17559 1 56 . 1 1 11 11 G H8 H 1 7.289 0.002 . 1 . . . . 11 G H8 . 17559 1 57 . 1 1 11 11 G C1' C 13 89.516 0.050 . 1 . . . . 11 G C1' . 17559 1 58 . 1 1 11 11 G C8 C 13 140.716 0.056 . 1 . . . . 11 G C8 . 17559 1 59 . 1 1 12 12 G H1' H 1 5.783 0.002 . 1 . . . . 12 G H1' . 17559 1 60 . 1 1 12 12 G H8 H 1 7.931 0.003 . 1 . . . . 12 G H8 . 17559 1 61 . 1 1 12 12 G C1' C 13 89.330 0.050 . 1 . . . . 12 G C1' . 17559 1 62 . 1 1 12 12 G C8 C 13 140.144 0.050 . 1 . . . . 12 G C8 . 17559 1 63 . 1 1 13 13 A H1' H 1 5.871 0.002 . 1 . . . . 13 A H1' . 17559 1 64 . 1 1 13 13 A H2 H 1 7.918 0.002 . 1 . . . . 13 A H2 . 17559 1 65 . 1 1 13 13 A H8 H 1 8.281 0.003 . 1 . . . . 13 A H8 . 17559 1 66 . 1 1 13 13 A C1' C 13 91.532 0.050 . 1 . . . . 13 A C1' . 17559 1 67 . 1 1 13 13 A C2 C 13 155.022 0.050 . 1 . . . . 13 A C2 . 17559 1 68 . 1 1 13 13 A C8 C 13 141.486 0.023 . 1 . . . . 13 A C8 . 17559 1 69 . 1 1 14 14 C H1' H 1 5.852 0.007 . 1 . . . . 14 C H1' . 17559 1 70 . 1 1 14 14 C H5 H 1 5.625 0.002 . 1 . . . . 14 C H5 . 17559 1 71 . 1 1 14 14 C H6 H 1 7.734 0.003 . 1 . . . . 14 C H6 . 17559 1 72 . 1 1 14 14 C C1' C 13 91.912 0.050 . 1 . . . . 14 C C1' . 17559 1 73 . 1 1 14 14 C C5 C 13 98.111 0.050 . 1 . . . . 14 C C5 . 17559 1 74 . 1 1 14 14 C C6 C 13 142.743 0.050 . 1 . . . . 14 C C6 . 17559 1 75 . 1 1 15 15 G H1' H 1 5.667 0.002 . 1 . . . . 15 G H1' . 17559 1 76 . 1 1 15 15 G H8 H 1 7.907 0.002 . 1 . . . . 15 G H8 . 17559 1 77 . 1 1 15 15 G C1' C 13 92.867 0.050 . 1 . . . . 15 G C1' . 17559 1 78 . 1 1 15 15 G C8 C 13 138.109 0.050 . 1 . . . . 15 G C8 . 17559 1 79 . 1 1 16 16 A H1' H 1 5.933 0.003 . 1 . . . . 16 A H1' . 17559 1 80 . 1 1 16 16 A H2 H 1 7.641 0.001 . 1 . . . . 16 A H2 . 17559 1 81 . 1 1 16 16 A H8 H 1 7.813 0.005 . 1 . . . . 16 A H8 . 17559 1 82 . 1 1 16 16 A C1' C 13 93.085 0.050 . 1 . . . . 16 A C1' . 17559 1 83 . 1 1 16 16 A C2 C 13 153.698 0.050 . 1 . . . . 16 A C2 . 17559 1 84 . 1 1 16 16 A C8 C 13 139.743 0.050 . 1 . . . . 16 A C8 . 17559 1 85 . 1 1 17 17 U H1' H 1 5.432 0.002 . 1 . . . . 17 U H1' . 17559 1 86 . 1 1 17 17 U H5 H 1 4.994 0.002 . 1 . . . . 17 U H5 . 17559 1 87 . 1 1 17 17 U H6 H 1 7.467 0.004 . 1 . . . . 17 U H6 . 17559 1 88 . 1 1 17 17 U C1' C 13 93.028 0.050 . 1 . . . . 17 U C1' . 17559 1 89 . 1 1 17 17 U C5 C 13 103.075 0.050 . 1 . . . . 17 U C5 . 17559 1 90 . 1 1 17 17 U C6 C 13 140.817 0.050 . 1 . . . . 17 U C6 . 17559 1 91 . 1 1 18 18 G H1' H 1 5.764 0.003 . 1 . . . . 18 G H1' . 17559 1 92 . 1 1 18 18 G H8 H 1 7.617 0.003 . 1 . . . . 18 G H8 . 17559 1 93 . 1 1 18 18 G C1' C 13 92.463 0.050 . 1 . . . . 18 G C1' . 17559 1 94 . 1 1 18 18 G C8 C 13 136.284 0.050 . 1 . . . . 18 G C8 . 17559 1 95 . 1 1 19 19 G H1' H 1 5.666 0.002 . 1 . . . . 19 G H1' . 17559 1 96 . 1 1 19 19 G H8 H 1 7.214 0.004 . 1 . . . . 19 G H8 . 17559 1 97 . 1 1 19 19 G C1' C 13 92.867 0.050 . 1 . . . . 19 G C1' . 17559 1 98 . 1 1 19 19 G C8 C 13 135.978 0.050 . 1 . . . . 19 G C8 . 17559 1 99 . 1 1 20 20 U H1' H 1 5.485 0.003 . 1 . . . . 20 U H1' . 17559 1 100 . 1 1 20 20 U H5 H 1 5.386 0.001 . 1 . . . . 20 U H5 . 17559 1 101 . 1 1 20 20 U H6 H 1 7.690 0.002 . 1 . . . . 20 U H6 . 17559 1 102 . 1 1 20 20 U C1' C 13 93.764 0.050 . 1 . . . . 20 U C1' . 17559 1 103 . 1 1 20 20 U C5 C 13 104.078 0.050 . 1 . . . . 20 U C5 . 17559 1 104 . 1 1 20 20 U C6 C 13 140.628 0.050 . 1 . . . . 20 U C6 . 17559 1 105 . 1 1 21 21 C H1' H 1 5.636 0.001 . 1 . . . . 21 C H1' . 17559 1 106 . 1 1 21 21 C H5 H 1 5.672 0.003 . 1 . . . . 21 C H5 . 17559 1 107 . 1 1 21 21 C H6 H 1 7.944 0.003 . 1 . . . . 21 C H6 . 17559 1 108 . 1 1 21 21 C C1' C 13 93.947 0.050 . 1 . . . . 21 C C1' . 17559 1 109 . 1 1 21 21 C C5 C 13 97.593 0.050 . 1 . . . . 21 C C5 . 17559 1 110 . 1 1 21 21 C C6 C 13 142.541 0.050 . 1 . . . . 21 C C6 . 17559 1 111 . 1 1 22 22 C H1' H 1 5.752 0.000 . 1 . . . . 22 C H1' . 17559 1 112 . 1 1 22 22 C H3' H 1 4.157 0.000 . 1 . . . . 22 C H3' . 17559 1 113 . 1 1 22 22 C H5 H 1 5.560 0.004 . 1 . . . . 22 C H5 . 17559 1 114 . 1 1 22 22 C H6 H 1 7.656 0.004 . 1 . . . . 22 C H6 . 17559 1 115 . 1 1 22 22 C C1' C 13 92.789 0.050 . 1 . . . . 22 C C1' . 17559 1 116 . 1 1 22 22 C C3' C 13 69.779 0.050 . 1 . . . . 22 C C3' . 17559 1 117 . 1 1 22 22 C C5 C 13 98.176 0.050 . 1 . . . . 22 C C5 . 17559 1 118 . 1 1 22 22 C C6 C 13 141.808 0.050 . 1 . . . . 22 C C6 . 17559 1 stop_ save_