data_17566 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 17566 _Entry.Title ; 22 nt artificial stemloop TASL1 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2011-04-01 _Entry.Accession_date 2011-04-01 _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Thomas Aeschbacher . . . 17566 2 Mario Schubert . . . 17566 3 Frederic Allain . . . 17566 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 17566 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 62 17566 '1H chemical shifts' 71 17566 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2012-03-08 2011-04-01 update BMRB 'update entry citation' 17566 1 . . 2012-01-24 2011-04-01 original author 'original release' 17566 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 17326 '20 nt RNA stem loop' 17566 BMRB 17559 'Assignment of the stem loop 2 of RsmZ' 17566 BMRB 17560 'Assignment of the stem loop 4 of RsmZ' 17566 BMRB 17567 '26 nt artificial stemloop TASL2' 17566 BMRB 17568 '30 nt artificial stemloop TASL3' 17566 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 17566 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 22252483 _Citation.Full_citation . _Citation.Title 'A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Biomol. NMR' _Citation.Journal_name_full 'Journal of biomolecular NMR' _Citation.Journal_volume 52 _Citation.Journal_issue 2 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 179 _Citation.Page_last 190 _Citation.Year 2012 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Thomas Aeschbacher . . . 17566 1 2 Mario Schubert . . . 17566 1 3 'Frederic H-T' Allain . . . 17566 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 17566 _Assembly.ID 1 _Assembly.Name TASL1 _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'TASL1 (monomer)' 1 $TASL1 A . yes native no no . . . 17566 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_TASL1 _Entity.Sf_category entity _Entity.Sf_framecode TASL1 _Entity.Entry_ID 17566 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name TASL1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGAUUCAUUUCGAUGAAUC CC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 17566 1 2 . G . 17566 1 3 . G . 17566 1 4 . A . 17566 1 5 . U . 17566 1 6 . U . 17566 1 7 . C . 17566 1 8 . A . 17566 1 9 . U . 17566 1 10 . U . 17566 1 11 . U . 17566 1 12 . C . 17566 1 13 . G . 17566 1 14 . A . 17566 1 15 . U . 17566 1 16 . G . 17566 1 17 . A . 17566 1 18 . A . 17566 1 19 . U . 17566 1 20 . C . 17566 1 21 . C . 17566 1 22 . C . 17566 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 17566 1 . G 2 2 17566 1 . G 3 3 17566 1 . A 4 4 17566 1 . U 5 5 17566 1 . U 6 6 17566 1 . C 7 7 17566 1 . A 8 8 17566 1 . U 9 9 17566 1 . U 10 10 17566 1 . U 11 11 17566 1 . C 12 12 17566 1 . G 13 13 17566 1 . A 14 14 17566 1 . U 15 15 17566 1 . G 16 16 17566 1 . A 17 17 17566 1 . A 18 18 17566 1 . U 19 19 17566 1 . C 20 20 17566 1 . C 21 21 17566 1 . C 22 22 17566 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 17566 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $TASL1 . . 'no natural source' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17566 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 17566 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $TASL1 . 'cell free synthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . 'Production method: In vitro transcription using a chemically synthesized DNA template.' . . 17566 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 17566 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 TASL1 'natural abundance' . . 1 $TASL1 . . 2 . . mM . . . . 17566 1 2 D2O 'natural abundance' . . . . . . 100 . . % . . . . 17566 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 17566 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '95% H2O/5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 TASL1 'natural abundance' . . 1 $TASL1 . . 2 . . mM . . . . 17566 2 2 H2O 'natural abundance' . . . . . . 95 . . % . . . . 17566 2 3 D2O 'natural abundance' . . . . . . 5 . . % . . . . 17566 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 17566 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH 7.4 . pH 17566 1 pressure 1 . atm 17566 1 temperature 303 . K 17566 1 stop_ save_ ############################ # Computer software used # ############################ save_TOPSPIN _Software.Sf_category software _Software.Sf_framecode TOPSPIN _Software.Entry_ID 17566 _Software.ID 1 _Software.Name TOPSPIN _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 17566 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID collection 17566 1 processing 17566 1 stop_ save_ save_SPARKY _Software.Sf_category software _Software.Sf_framecode SPARKY _Software.Entry_ID 17566 _Software.ID 2 _Software.Name SPARKY _Software.Version . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 17566 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 17566 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 17566 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 17566 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 700 . . . 17566 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 17566 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17566 1 2 '2D 1H-13C HSQC' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17566 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17566 1 4 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17566 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 17566 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.00 . indirect 0.251449530 . . . . . . . . . 17566 1 H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . . . . . 17566 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 17566 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H TOCSY' . . . 17566 1 2 '2D 1H-13C HSQC' . . . 17566 1 3 '2D 1H-1H NOESY' . . . 17566 1 4 '2D 1H-1H NOESY' . . . 17566 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1 H 1 12.571 0.002 0 . 5 . . . 1 G H1 . 17566 1 2 . 1 1 1 1 G H1' H 1 5.856 0.002 5 . 1 . . . 1 G H1' . 17566 1 3 . 1 1 1 1 G H8 H 1 8.161 0.002 5 . 1 . . . 1 G H8 . 17566 1 4 . 1 1 1 1 G C1' C 13 91.471 0.050 2 . 1 . . . 1 G C1' . 17566 1 5 . 1 1 1 1 G C8 C 13 139.159 0.050 2 . 1 . . . 1 G C8 . 17566 1 6 . 1 1 2 2 G H1 H 1 12.704 0.002 0 . 5 . . . 2 G H1 . 17566 1 7 . 1 1 2 2 G H1' H 1 5.963 0.002 5 . 1 . . . 2 G H1' . 17566 1 8 . 1 1 2 2 G H8 H 1 7.568 0.002 7 . 1 . . . 2 G H8 . 17566 1 9 . 1 1 2 2 G C1' C 13 92.837 0.050 2 . 1 . . . 2 G C1' . 17566 1 10 . 1 1 2 2 G C8 C 13 136.918 0.050 2 . 1 . . . 2 G C8 . 17566 1 11 . 1 1 3 3 G H1 H 1 12.380 0.002 0 . 5 . . . 3 G H1 . 17566 1 12 . 1 1 3 3 G H1' H 1 5.821 0.002 5 . 1 . . . 3 G H1' . 17566 1 13 . 1 1 3 3 G H8 H 1 7.251 0.002 6 . 1 . . . 3 G H8 . 17566 1 14 . 1 1 3 3 G C1' C 13 92.961 0.050 2 . 1 . . . 3 G C1' . 17566 1 15 . 1 1 3 3 G C8 C 13 136.293 0.050 2 . 1 . . . 3 G C8 . 17566 1 16 . 1 1 4 4 A H1' H 1 6.018 0.002 7 . 1 . . . 4 A H1' . 17566 1 17 . 1 1 4 4 A H2 H 1 7.822 0.002 5 . 1 . . . 4 A H2 . 17566 1 18 . 1 1 4 4 A H8 H 1 7.746 0.002 6 . 1 . . . 4 A H8 . 17566 1 19 . 1 1 4 4 A C1' C 13 93.274 0.050 2 . 1 . . . 4 A C1' . 17566 1 20 . 1 1 4 4 A C2 C 13 153.900 0.050 2 . 1 . . . 4 A C2 . 17566 1 21 . 1 1 4 4 A C8 C 13 139.543 0.050 1 . 1 . . . 4 A C8 . 17566 1 22 . 1 1 5 5 U H1' H 1 5.503 0.005 8 . 1 . . . 5 U H1' . 17566 1 23 . 1 1 5 5 U H3 H 1 14.131 0.002 0 . 1 . . . 5 U H3 . 17566 1 24 . 1 1 5 5 U H5 H 1 5.095 0.002 6 . 1 . . . 5 U H5 . 17566 1 25 . 1 1 5 5 U H6 H 1 7.571 0.002 7 . 1 . . . 5 U H6 . 17566 1 26 . 1 1 5 5 U C1' C 13 93.414 0.300 2 . 1 . . . 5 U C1' . 17566 1 27 . 1 1 5 5 U C5 C 13 102.896 0.050 2 . 1 . . . 5 U C5 . 17566 1 28 . 1 1 5 5 U C6 C 13 141.468 0.050 1 . 1 . . . 5 U C6 . 17566 1 29 . 1 1 6 6 U H1' H 1 5.677 0.002 7 . 1 . . . 6 U H1' . 17566 1 30 . 1 1 6 6 U H3 H 1 13.715 0.002 0 . 1 . . . 6 U H3 . 17566 1 31 . 1 1 6 6 U H5 H 1 5.566 0.003 7 . 1 . . . 6 U H5 . 17566 1 32 . 1 1 6 6 U H6 H 1 7.976 0.002 7 . 1 . . . 6 U H6 . 17566 1 33 . 1 1 6 6 U C1' C 13 93.774 0.050 2 . 1 . . . 6 U C1' . 17566 1 34 . 1 1 6 6 U C5 C 13 103.448 0.050 2 . 1 . . . 6 U C5 . 17566 1 35 . 1 1 6 6 U C6 C 13 142.443 0.050 1 . 1 . . . 6 U C6 . 17566 1 36 . 1 1 7 7 C H1' H 1 5.545 0.002 6 . 1 . . . 7 C H1' . 17566 1 37 . 1 1 7 7 C H5 H 1 5.706 0.002 5 . 1 . . . 7 C H5 . 17566 1 38 . 1 1 7 7 C H6 H 1 7.873 0.004 7 . 1 . . . 7 C H6 . 17566 1 39 . 1 1 7 7 C C1' C 13 93.772 0.300 2 . 1 . . . 7 C C1' . 17566 1 40 . 1 1 7 7 C C5 C 13 97.955 0.050 2 . 1 . . . 7 C C5 . 17566 1 41 . 1 1 7 7 C C6 C 13 141.656 0.100 1 . 1 . . . 7 C C6 . 17566 1 42 . 1 1 8 8 A H1' H 1 5.919 0.002 7 . 1 . . . 8 A H1' . 17566 1 43 . 1 1 8 8 A H2 H 1 7.317 0.002 9 . 1 . . . 8 A H2 . 17566 1 44 . 1 1 8 8 A H8 H 1 8.075 0.002 6 . 1 . . . 8 A H8 . 17566 1 45 . 1 1 8 8 A C1' C 13 92.900 0.050 2 . 1 . . . 8 A C1' . 17566 1 46 . 1 1 8 8 A C2 C 13 153.079 0.050 2 . 1 . . . 8 A C2 . 17566 1 47 . 1 1 8 8 A C8 C 13 139.769 0.050 1 . 1 . . . 8 A C8 . 17566 1 48 . 1 1 9 9 U H1' H 1 5.490 0.002 8 . 1 . . . 9 U H1' . 17566 1 49 . 1 1 9 9 U H5 H 1 4.990 0.003 6 . 1 . . . 9 U H5 . 17566 1 50 . 1 1 9 9 U H6 H 1 7.432 0.002 9 . 1 . . . 9 U H6 . 17566 1 51 . 1 1 9 9 U C1' C 13 93.281 0.200 2 . 1 . . . 9 U C1' . 17566 1 52 . 1 1 9 9 U C5 C 13 102.770 0.100 2 . 1 . . . 9 U C5 . 17566 1 53 . 1 1 9 9 U C6 C 13 140.950 0.050 1 . 1 . . . 9 U C6 . 17566 1 54 . 1 1 10 10 U H1' H 1 5.383 0.002 9 . 1 . . . 10 U H1' . 17566 1 55 . 1 1 10 10 U H5 H 1 5.742 0.002 7 . 1 . . . 10 U H5 . 17566 1 56 . 1 1 10 10 U H6 H 1 7.750 0.002 7 . 1 . . . 10 U H6 . 17566 1 57 . 1 1 10 10 U C1' C 13 94.413 0.050 2 . 1 . . . 10 U C1' . 17566 1 58 . 1 1 10 10 U C5 C 13 105.225 0.050 2 . 1 . . . 10 U C5 . 17566 1 59 . 1 1 10 10 U C6 C 13 140.719 0.050 1 . 1 . . . 10 U C6 . 17566 1 60 . 1 1 11 11 U H1' H 1 6.106 0.002 5 . 1 . . . 11 U H1' . 17566 1 61 . 1 1 11 11 U H5 H 1 5.883 0.002 5 . 1 . . . 11 U H5 . 17566 1 62 . 1 1 11 11 U H6 H 1 8.029 0.002 7 . 1 . . . 11 U H6 . 17566 1 63 . 1 1 11 11 U C1' C 13 89.264 0.050 2 . 1 . . . 11 U C1' . 17566 1 64 . 1 1 11 11 U C5 C 13 105.509 0.050 2 . 1 . . . 11 U C5 . 17566 1 65 . 1 1 11 11 U C6 C 13 144.690 0.050 1 . 1 . . . 11 U C6 . 17566 1 66 . 1 1 12 12 C H1' H 1 5.933 0.002 6 . 1 . . . 12 C H1' . 17566 1 67 . 1 1 12 12 C H5 H 1 6.128 0.002 7 . 1 . . . 12 C H5 . 17566 1 68 . 1 1 12 12 C H6 H 1 7.691 0.002 5 . 1 . . . 12 C H6 . 17566 1 69 . 1 1 12 12 C C1' C 13 89.160 0.050 2 . 1 . . . 12 C C1' . 17566 1 70 . 1 1 12 12 C C5 C 13 98.748 0.050 2 . 1 . . . 12 C C5 . 17566 1 71 . 1 1 12 12 C C6 C 13 142.888 0.050 1 . 1 . . . 12 C C6 . 17566 1 72 . 1 1 13 13 G H1' H 1 5.973 0.002 7 . 1 . . . 13 G H1' . 17566 1 73 . 1 1 13 13 G H3' H 1 5.652 0.002 4 . 1 . . . 13 G H3' . 17566 1 74 . 1 1 13 13 G H8 H 1 7.884 0.002 6 . 1 . . . 13 G H8 . 17566 1 75 . 1 1 13 13 G C1' C 13 94.278 0.002 2 . 1 . . . 13 G C1' . 17566 1 76 . 1 1 13 13 G C8 C 13 142.923 0.002 1 . 1 . . . 13 G C8 . 17566 1 77 . 1 1 14 14 A H1' H 1 4.788 0.002 9 . 1 . . . 14 A H1' . 17566 1 78 . 1 1 14 14 A H2 H 1 7.882 0.002 8 . 1 . . . 14 A H2 . 17566 1 79 . 1 1 14 14 A H8 H 1 8.646 0.002 10 . 1 . . . 14 A H8 . 17566 1 80 . 1 1 14 14 A C1' C 13 93.460 0.050 2 . 1 . . . 14 A C1' . 17566 1 81 . 1 1 14 14 A C2 C 13 153.491 0.050 2 . 1 . . . 14 A C2 . 17566 1 82 . 1 1 14 14 A C8 C 13 142.090 0.050 2 . 1 . . . 14 A C8 . 17566 1 83 . 1 1 15 15 U H1' H 1 5.508 0.002 8 . 1 . . . 15 U H1' . 17566 1 84 . 1 1 15 15 U H3 H 1 13.581 0.002 0 . 1 . . . 15 U H3 . 17566 1 85 . 1 1 15 15 U H5 H 1 5.039 0.002 5 . 1 . . . 15 U H5 . 17566 1 86 . 1 1 15 15 U H6 H 1 7.536 0.002 11 . 1 . . . 15 U H6 . 17566 1 87 . 1 1 15 15 U C1' C 13 93.585 0.100 2 . 1 . . . 15 U C1' . 17566 1 88 . 1 1 15 15 U C5 C 13 102.823 0.050 2 . 1 . . . 15 U C5 . 17566 1 89 . 1 1 15 15 U C6 C 13 141.292 0.050 1 . 1 . . . 15 U C6 . 17566 1 90 . 1 1 16 16 G H1 H 1 11.633 0.002 0 . 1 . . . 16 G H1 . 17566 1 91 . 1 1 16 16 G H1' H 1 5.796 0.003 7 . 1 . . . 16 G H1' . 17566 1 92 . 1 1 16 16 G H8 H 1 7.716 0.002 7 . 1 . . . 16 G H8 . 17566 1 93 . 1 1 16 16 G C1' C 13 92.513 0.100 2 . 1 . . . 16 G C1' . 17566 1 94 . 1 1 16 16 G C8 C 13 136.589 0.050 1 . 1 . . . 16 G C8 . 17566 1 95 . 1 1 17 17 A H1' H 1 5.863 0.002 5 . 1 . . . 17 A H1' . 17566 1 96 . 1 1 17 17 A H2 H 1 7.139 0.002 8 . 1 . . . 17 A H2 . 17566 1 97 . 1 1 17 17 A H8 H 1 7.760 0.002 3 . 1 . . . 17 A H8 . 17566 1 98 . 1 1 17 17 A C1' C 13 92.969 0.050 2 . 1 . . . 17 A C1' . 17566 1 99 . 1 1 17 17 A C2 C 13 152.998 0.050 2 . 1 . . . 17 A C2 . 17566 1 100 . 1 1 17 17 A C8 C 13 139.522 0.150 1 . 1 . . . 17 A C8 . 17566 1 101 . 1 1 18 18 A H1' H 1 5.889 0.002 8 . 1 . . . 18 A H1' . 17566 1 102 . 1 1 18 18 A H2 H 1 7.792 0.002 6 . 1 . . . 18 A H2 . 17566 1 103 . 1 1 18 18 A H8 H 1 7.754 0.002 7 . 1 . . . 18 A H8 . 17566 1 104 . 1 1 18 18 A C1' C 13 92.871 0.150 2 . 1 . . . 18 A C1' . 17566 1 105 . 1 1 18 18 A C2 C 13 153.795 0.050 2 . 1 . . . 18 A C2 . 17566 1 106 . 1 1 18 18 A C8 C 13 139.524 0.050 1 . 1 . . . 18 A C8 . 17566 1 107 . 1 1 19 19 U H1' H 1 5.534 0.002 9 . 1 . . . 19 U H1' . 17566 1 108 . 1 1 19 19 U H3 H 1 14.029 0.002 0 . 1 . . . 19 U H3 . 17566 1 109 . 1 1 19 19 U H5 H 1 4.999 0.004 6 . 1 . . . 19 U H5 . 17566 1 110 . 1 1 19 19 U H6 H 1 7.632 0.002 8 . 1 . . . 19 U H6 . 17566 1 111 . 1 1 19 19 U C1' C 13 93.449 0.150 2 . 1 . . . 19 U C1' . 17566 1 112 . 1 1 19 19 U C5 C 13 102.770 0.100 2 . 1 . . . 19 U C5 . 17566 1 113 . 1 1 19 19 U C6 C 13 141.533 0.050 1 . 1 . . . 19 U C6 . 17566 1 114 . 1 1 20 20 C H1' H 1 5.601 0.002 5 . 1 . . . 20 C H1' . 17566 1 115 . 1 1 20 20 C H5 H 1 5.604 0.002 6 . 1 . . . 20 C H5 . 17566 1 116 . 1 1 20 20 C H6 H 1 7.857 0.003 5 . 1 . . . 20 C H6 . 17566 1 117 . 1 1 20 20 C C1' C 13 94.101 0.050 2 . 1 . . . 20 C C1' . 17566 1 118 . 1 1 20 20 C C5 C 13 97.589 0.050 2 . 1 . . . 20 C C5 . 17566 1 119 . 1 1 20 20 C C6 C 13 141.656 0.100 1 . 1 . . . 20 C C6 . 17566 1 120 . 1 1 21 21 C H1' H 1 5.503 0.005 3 . 1 . . . 21 C H1' . 17566 1 121 . 1 1 21 21 C H5 H 1 5.497 0.002 5 . 1 . . . 21 C H5 . 17566 1 122 . 1 1 21 21 C H6 H 1 7.820 0.002 3 . 1 . . . 21 C H6 . 17566 1 123 . 1 1 21 21 C C1' C 13 93.760 0.100 2 . 1 . . . 21 C C1' . 17566 1 124 . 1 1 21 21 C C5 C 13 97.647 0.100 2 . 1 . . . 21 C C5 . 17566 1 125 . 1 1 21 21 C C6 C 13 141.638 0.050 1 . 1 . . . 21 C C6 . 17566 1 126 . 1 1 22 22 C H1' H 1 5.783 0.002 4 . 1 . . . 22 C H1' . 17566 1 127 . 1 1 22 22 C H3' H 1 4.204 0.002 1 . 1 . . . 22 C H3' . 17566 1 128 . 1 1 22 22 C H5 H 1 5.507 0.002 4 . 1 . . . 22 C H5 . 17566 1 129 . 1 1 22 22 C H6 H 1 7.699 0.002 4 . 1 . . . 22 C H6 . 17566 1 130 . 1 1 22 22 C C1' C 13 92.782 0.100 2 . 1 . . . 22 C C1' . 17566 1 131 . 1 1 22 22 C C3' C 13 69.842 0.050 1 . 1 . . . 22 C C3' . 17566 1 132 . 1 1 22 22 C C5 C 13 97.997 0.100 2 . 1 . . . 22 C C5 . 17566 1 133 . 1 1 22 22 C C6 C 13 141.926 0.050 1 . 1 . . . 22 C C6 . 17566 1 stop_ save_