data_17877 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 17877 _Entry.Title ; Solution structure of a shortened antiterminator hairpin from a Mg2+ riboswitch ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2011-08-22 _Entry.Accession_date 2011-08-22 _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Maximiliane Korth . 'M. T.' . 17877 2 Roland Sigel . 'K. O.' . 17877 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 17877 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID RNA . 17877 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 17877 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 232 17877 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2014-02-26 2011-08-22 update BMRB 'update entry citation' 17877 1 . . 2012-08-22 2011-08-22 original author 'original release' 17877 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 2LI4 'BMRB Entry Tracking System' 17877 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 17877 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 22976989 _Citation.Full_citation . _Citation.Title 'Unusually high-affinity Mg(2+) binding at the AU-rich sequence within the antiterminator hairpin of a Mg(2+) riboswitch.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Chem. Biodivers.' _Citation.Journal_name_full 'Chemistry & biodiversity' _Citation.Journal_volume 9 _Citation.Journal_issue 9 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 2035 _Citation.Page_last 2049 _Citation.Year 2012 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Maximiliane Korth . M.T. . 17877 1 2 Roland Sigel . K.O. . 17877 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 17877 _Assembly.ID 1 _Assembly.Name 'RNA (32-MER)' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'RNA (32-MER)' 1 $RNA_(32-MER) A . yes native no no . . . 17877 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_RNA_(32-MER) _Entity.Sf_category entity _Entity.Sf_framecode RNA_(32-MER) _Entity.Entry_ID 17877 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name RNA_(32-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGACCGAUAAGGUAGAAAUG CCUUAUCGGUCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 32 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 10304.251 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 17877 1 2 . G . 17877 1 3 . A . 17877 1 4 . C . 17877 1 5 . C . 17877 1 6 . G . 17877 1 7 . A . 17877 1 8 . U . 17877 1 9 . A . 17877 1 10 . A . 17877 1 11 . G . 17877 1 12 . G . 17877 1 13 . U . 17877 1 14 . A . 17877 1 15 . G . 17877 1 16 . A . 17877 1 17 . A . 17877 1 18 . A . 17877 1 19 . U . 17877 1 20 . G . 17877 1 21 . C . 17877 1 22 . C . 17877 1 23 . U . 17877 1 24 . U . 17877 1 25 . A . 17877 1 26 . U . 17877 1 27 . C . 17877 1 28 . G . 17877 1 29 . G . 17877 1 30 . U . 17877 1 31 . C . 17877 1 32 . C . 17877 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 17877 1 . G 2 2 17877 1 . A 3 3 17877 1 . C 4 4 17877 1 . C 5 5 17877 1 . G 6 6 17877 1 . A 7 7 17877 1 . U 8 8 17877 1 . A 9 9 17877 1 . A 10 10 17877 1 . G 11 11 17877 1 . G 12 12 17877 1 . U 13 13 17877 1 . A 14 14 17877 1 . G 15 15 17877 1 . A 16 16 17877 1 . A 17 17 17877 1 . A 18 18 17877 1 . U 19 19 17877 1 . G 20 20 17877 1 . C 21 21 17877 1 . C 22 22 17877 1 . U 23 23 17877 1 . U 24 24 17877 1 . A 25 25 17877 1 . U 26 26 17877 1 . C 27 27 17877 1 . G 28 28 17877 1 . G 29 29 17877 1 . U 30 30 17877 1 . C 31 31 17877 1 . C 32 32 17877 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 17877 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $RNA_(32-MER) . 630 organism . 'Yersinia enterocolitica' 'Yersinia enterocolitica' . . Bacteria . Yersinia enterocolitica . . . . . . . . . . . . . . . . . . . . . 17877 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 17877 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $RNA_(32-MER) . 'cell free synthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17877 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 17877 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details 'YE loop C short' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'potassium chloride' 'natural abundance' . . . . . . 50 . . mM . . . . 17877 1 2 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 17877 1 3 'RNA (32-MER)' 'natural abundance' . . 1 $RNA_(32-MER) . . 0.24 . . mM . . . . 17877 1 4 D2O 'natural abundance' . . . . . . 100 . . % . . . . 17877 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 17877 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details 'YE loop C short' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'potassium chloride' 'natural abundance' . . . . . . 50 . . mM . . . . 17877 2 2 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 17877 2 3 'RNA (32-MER)' 'natural abundance' . . 1 $RNA_(32-MER) . . 0.6 . . mM . . . . 17877 2 4 D2O 'natural abundance' . . . . . . 10 . . % . . . . 17877 2 5 H2O 'natural abundance' . . . . . . 90 . . % . . . . 17877 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 17877 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details 'YE loop C short, partially deuterated' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'potassium chloride' 'natural abundance' . . . . . . 50 . . mM . . . . 17877 3 2 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 17877 3 3 'RNA (32-MER)' 'natural abundance' . . 1 $RNA_(32-MER) . . 0.8 . . mM . . . . 17877 3 4 D2O 'natural abundance' . . . . . . 100 . . % . . . . 17877 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 17877 _Sample.ID 4 _Sample.Type solution _Sample.Sub_type . _Sample.Details 'YE loop C short' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'potassium chloride' 'natural abundance' . . . . . . 50 . . mM . . . . 17877 4 2 EDTA 'natural abundance' . . . . . . 10 . . uM . . . . 17877 4 3 'RNA (32-MER)' 'natural abundance' . . 1 $RNA_(32-MER) . . 0.5 . . mM . . . . 17877 4 4 D2O 'natural abundance' . . . . . . 100 . . % . . . . 17877 4 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 17877 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.05 . M 17877 1 pH 6.8 . pH 17877 1 pressure 1 . atm 17877 1 temperature 303 . K 17877 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 17877 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.05 . M 17877 2 pH 6.8 . pH 17877 2 pressure 1 . atm 17877 2 temperature 278 . K 17877 2 stop_ save_ save_sample_conditions_3 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_3 _Sample_condition_list.Entry_ID 17877 _Sample_condition_list.ID 3 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.05 . M 17877 3 pH 6.8 . pH 17877 3 pressure 1 . atm 17877 3 temperature 293 . K 17877 3 stop_ save_ ############################ # Computer software used # ############################ save_CNS _Software.Sf_category software _Software.Sf_framecode CNS _Software.Entry_ID 17877 _Software.ID 1 _Software.Name CNS _Software.Version 1.2 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Brunger, Adams, Clore, Gros, Nilges and Read' . . 17877 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 17877 1 stop_ save_ save_SPARKY _Software.Sf_category software _Software.Sf_framecode SPARKY _Software.Entry_ID 17877 _Software.ID 2 _Software.Name SPARKY _Software.Version 3.1 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 17877 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 17877 2 'data analysis' 17877 2 'peak picking' 17877 2 stop_ save_ save_TOPSPIN _Software.Sf_category software _Software.Sf_framecode TOPSPIN _Software.Entry_ID 17877 _Software.ID 3 _Software.Name TOPSPIN _Software.Version '1.3, 2.1, 3.0a' _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 17877 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID processing 17877 3 stop_ save_ save_X-PLOR _Software.Sf_category software _Software.Sf_framecode X-PLOR _Software.Entry_ID 17877 _Software.ID 4 _Software.Name X-PLOR _Software.Version 2.24 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 17877 4 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 17877 4 'structure solution' 17877 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 17877 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 17877 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 700 . . . 17877 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 17877 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17877 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17877 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . 3 $sample_3 isotropic . . 1 $sample_conditions_1 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17877 1 4 '2D 1H-1H TOCSY' no . . . . . . . . . . 4 $sample_4 isotropic . . 3 $sample_conditions_3 . . . 1 $spectrometer_1 . . . . . . . . . . . . . . . . 17877 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 17877 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 TMS 'methyl protons' . . . . ppm 0 external indirect 1 . . . . . . . . . 17877 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 17877 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 17877 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H1' H 1 5.804 0.001 . 1 . . . A 1 G H1' . 17877 1 2 . 1 1 1 1 G H2' H 1 4.925 0.000 . 1 . . . A 1 G H2' . 17877 1 3 . 1 1 1 1 G H3' H 1 4.541 0.000 . 1 . . . A 1 G H3' . 17877 1 4 . 1 1 1 1 G H4' H 1 4.473 0.000 . 1 . . . A 1 G H4' . 17877 1 5 . 1 1 1 1 G H5' H 1 4.396 0.000 . 1 . . . A 1 G H5' . 17877 1 6 . 1 1 1 1 G H5'' H 1 4.278 0.000 . 1 . . . A 1 G H5'' . 17877 1 7 . 1 1 1 1 G H8 H 1 8.134 0.003 . 1 . . . A 1 G H8 . 17877 1 8 . 1 1 2 2 G H1' H 1 5.881 0.001 . 1 . . . A 2 G H1' . 17877 1 9 . 1 1 2 2 G H2' H 1 4.646 0.001 . 1 . . . A 2 G H2' . 17877 1 10 . 1 1 2 2 G H3' H 1 4.579 0.002 . 1 . . . A 2 G H3' . 17877 1 11 . 1 1 2 2 G H4' H 1 4.490 0.000 . 1 . . . A 2 G H4' . 17877 1 12 . 1 1 2 2 G H5' H 1 4.316 0.000 . 1 . . . A 2 G H5' . 17877 1 13 . 1 1 2 2 G H5'' H 1 4.296 0.000 . 1 . . . A 2 G H5'' . 17877 1 14 . 1 1 2 2 G H8 H 1 7.599 0.002 . 1 . . . A 2 G H8 . 17877 1 15 . 1 1 3 3 A H1' H 1 6.007 0.003 . 1 . . . A 3 A H1' . 17877 1 16 . 1 1 3 3 A H2 H 1 7.802 0.003 . 1 . . . A 3 A H2 . 17877 1 17 . 1 1 3 3 A H2' H 1 4.581 0.003 . 1 . . . A 3 A H2' . 17877 1 18 . 1 1 3 3 A H3' H 1 4.620 0.002 . 1 . . . A 3 A H3' . 17877 1 19 . 1 1 3 3 A H4' H 1 4.433 0.000 . 1 . . . A 3 A H4' . 17877 1 20 . 1 1 3 3 A H5'' H 1 4.233 0.000 . 1 . . . A 3 A H5'' . 17877 1 21 . 1 1 3 3 A H8 H 1 7.905 0.003 . 1 . . . A 3 A H8 . 17877 1 22 . 1 1 4 4 C H1' H 1 5.359 0.002 . 1 . . . A 4 C H1' . 17877 1 23 . 1 1 4 4 C H2' H 1 4.249 0.001 . 1 . . . A 4 C H2' . 17877 1 24 . 1 1 4 4 C H3' H 1 4.294 0.003 . 1 . . . A 4 C H3' . 17877 1 25 . 1 1 4 4 C H4' H 1 4.486 0.000 . 1 . . . A 4 C H4' . 17877 1 26 . 1 1 4 4 C H5 H 1 5.219 0.003 . 1 . . . A 4 C H5 . 17877 1 27 . 1 1 4 4 C H5' H 1 4.393 0.000 . 1 . . . A 4 C H5' . 17877 1 28 . 1 1 4 4 C H5'' H 1 4.028 0.000 . 1 . . . A 4 C H5'' . 17877 1 29 . 1 1 4 4 C H6 H 1 7.378 0.003 . 1 . . . A 4 C H6 . 17877 1 30 . 1 1 5 5 C H1' H 1 5.501 0.002 . 1 . . . A 5 C H1' . 17877 1 31 . 1 1 5 5 C H2' H 1 4.579 0.002 . 1 . . . A 5 C H2' . 17877 1 32 . 1 1 5 5 C H3' H 1 4.486 0.000 . 1 . . . A 5 C H3' . 17877 1 33 . 1 1 5 5 C H4' H 1 4.351 0.002 . 1 . . . A 5 C H4' . 17877 1 34 . 1 1 5 5 C H5 H 1 5.439 0.003 . 1 . . . A 5 C H5 . 17877 1 35 . 1 1 5 5 C H5' H 1 4.122 0.000 . 1 . . . A 5 C H5' . 17877 1 36 . 1 1 5 5 C H5'' H 1 4.058 0.000 . 1 . . . A 5 C H5'' . 17877 1 37 . 1 1 5 5 C H6 H 1 7.649 0.003 . 1 . . . A 5 C H6 . 17877 1 38 . 1 1 6 6 G H1' H 1 5.652 0.001 . 1 . . . A 6 G H1' . 17877 1 39 . 1 1 6 6 G H2' H 1 4.648 0.001 . 1 . . . A 6 G H2' . 17877 1 40 . 1 1 6 6 G H3' H 1 4.518 0.000 . 1 . . . A 6 G H3' . 17877 1 41 . 1 1 6 6 G H4' H 1 4.112 0.000 . 1 . . . A 6 G H4' . 17877 1 42 . 1 1 6 6 G H5' H 1 4.256 0.000 . 1 . . . A 6 G H5' . 17877 1 43 . 1 1 6 6 G H5'' H 1 4.038 0.000 . 1 . . . A 6 G H5'' . 17877 1 44 . 1 1 6 6 G H8 H 1 7.496 0.003 . 1 . . . A 6 G H8 . 17877 1 45 . 1 1 7 7 A H1' H 1 5.916 0.003 . 1 . . . A 7 A H1' . 17877 1 46 . 1 1 7 7 A H2 H 1 7.602 0.002 . 1 . . . A 7 A H2 . 17877 1 47 . 1 1 7 7 A H2' H 1 4.482 0.002 . 1 . . . A 7 A H2' . 17877 1 48 . 1 1 7 7 A H3' H 1 4.585 0.001 . 1 . . . A 7 A H3' . 17877 1 49 . 1 1 7 7 A H4' H 1 4.495 0.002 . 1 . . . A 7 A H4' . 17877 1 50 . 1 1 7 7 A H5'' H 1 4.129 0.000 . 1 . . . A 7 A H5'' . 17877 1 51 . 1 1 7 7 A H8 H 1 7.786 0.003 . 1 . . . A 7 A H8 . 17877 1 52 . 1 1 8 8 U H1' H 1 5.395 0.001 . 1 . . . A 8 U H1' . 17877 1 53 . 1 1 8 8 U H2' H 1 4.415 0.001 . 1 . . . A 8 U H2' . 17877 1 54 . 1 1 8 8 U H3' H 1 4.391 0.001 . 1 . . . A 8 U H3' . 17877 1 55 . 1 1 8 8 U H4' H 1 4.102 0.000 . 1 . . . A 8 U H4' . 17877 1 56 . 1 1 8 8 U H5 H 1 5.018 0.003 . 1 . . . A 8 U H5 . 17877 1 57 . 1 1 8 8 U H5' H 1 4.082 0.000 . 1 . . . A 8 U H5' . 17877 1 58 . 1 1 8 8 U H5'' H 1 4.064 0.000 . 1 . . . A 8 U H5'' . 17877 1 59 . 1 1 8 8 U H6 H 1 7.505 0.002 . 1 . . . A 8 U H6 . 17877 1 60 . 1 1 9 9 A H1' H 1 5.885 0.003 . 1 . . . A 9 A H1' . 17877 1 61 . 1 1 9 9 A H2 H 1 6.371 0.001 . 1 . . . A 9 A H2 . 17877 1 62 . 1 1 9 9 A H2' H 1 4.534 0.001 . 1 . . . A 9 A H2' . 17877 1 63 . 1 1 9 9 A H3' H 1 4.698 0.002 . 1 . . . A 9 A H3' . 17877 1 64 . 1 1 9 9 A H4' H 1 4.218 0.000 . 1 . . . A 9 A H4' . 17877 1 65 . 1 1 9 9 A H5' H 1 4.159 0.001 . 1 . . . A 9 A H5' . 17877 1 66 . 1 1 9 9 A H5'' H 1 4.146 0.002 . 1 . . . A 9 A H5'' . 17877 1 67 . 1 1 9 9 A H8 H 1 8.020 0.003 . 1 . . . A 9 A H8 . 17877 1 68 . 1 1 10 10 A H1' H 1 5.817 0.001 . 1 . . . A 10 A H1' . 17877 1 69 . 1 1 10 10 A H2 H 1 7.323 0.001 . 1 . . . A 10 A H2 . 17877 1 70 . 1 1 10 10 A H2' H 1 4.558 0.000 . 1 . . . A 10 A H2' . 17877 1 71 . 1 1 10 10 A H3' H 1 4.604 0.001 . 1 . . . A 10 A H3' . 17877 1 72 . 1 1 10 10 A H4' H 1 4.475 0.000 . 1 . . . A 10 A H4' . 17877 1 73 . 1 1 10 10 A H5' H 1 4.149 0.000 . 1 . . . A 10 A H5' . 17877 1 74 . 1 1 10 10 A H5'' H 1 4.120 0.000 . 1 . . . A 10 A H5'' . 17877 1 75 . 1 1 10 10 A H8 H 1 7.736 0.002 . 1 . . . A 10 A H8 . 17877 1 76 . 1 1 11 11 G H1' H 1 5.531 0.001 . 1 . . . A 11 G H1' . 17877 1 77 . 1 1 11 11 G H2' H 1 4.502 0.001 . 1 . . . A 11 G H2' . 17877 1 78 . 1 1 11 11 G H3' H 1 4.385 0.001 . 1 . . . A 11 G H3' . 17877 1 79 . 1 1 11 11 G H4' H 1 4.415 0.001 . 1 . . . A 11 G H4' . 17877 1 80 . 1 1 11 11 G H5' H 1 4.036 0.000 . 1 . . . A 11 G H5' . 17877 1 81 . 1 1 11 11 G H5'' H 1 4.030 0.000 . 1 . . . A 11 G H5'' . 17877 1 82 . 1 1 11 11 G H8 H 1 7.059 0.002 . 1 . . . A 11 G H8 . 17877 1 83 . 1 1 12 12 G H1' H 1 5.699 0.002 . 1 . . . A 12 G H1' . 17877 1 84 . 1 1 12 12 G H2' H 1 4.564 0.000 . 1 . . . A 12 G H2' . 17877 1 85 . 1 1 12 12 G H3' H 1 4.421 0.002 . 1 . . . A 12 G H3' . 17877 1 86 . 1 1 12 12 G H4' H 1 4.340 0.000 . 1 . . . A 12 G H4' . 17877 1 87 . 1 1 12 12 G H5' H 1 4.327 0.000 . 1 . . . A 12 G H5' . 17877 1 88 . 1 1 12 12 G H5'' H 1 4.027 0.000 . 1 . . . A 12 G H5'' . 17877 1 89 . 1 1 12 12 G H8 H 1 7.087 0.002 . 1 . . . A 12 G H8 . 17877 1 90 . 1 1 13 13 U H1' H 1 5.472 0.002 . 1 . . . A 13 U H1' . 17877 1 91 . 1 1 13 13 U H2' H 1 4.206 0.001 . 1 . . . A 13 U H2' . 17877 1 92 . 1 1 13 13 U H3' H 1 4.597 0.001 . 1 . . . A 13 U H3' . 17877 1 93 . 1 1 13 13 U H4' H 1 4.310 0.000 . 1 . . . A 13 U H4' . 17877 1 94 . 1 1 13 13 U H5 H 1 5.411 0.003 . 1 . . . A 13 U H5 . 17877 1 95 . 1 1 13 13 U H5' H 1 4.070 0.002 . 1 . . . A 13 U H5' . 17877 1 96 . 1 1 13 13 U H5'' H 1 4.061 0.002 . 1 . . . A 13 U H5'' . 17877 1 97 . 1 1 13 13 U H6 H 1 7.663 0.002 . 1 . . . A 13 U H6 . 17877 1 98 . 1 1 14 14 A H1' H 1 5.982 0.002 . 1 . . . A 14 A H1' . 17877 1 99 . 1 1 14 14 A H2 H 1 7.307 0.001 . 1 . . . A 14 A H2 . 17877 1 100 . 1 1 14 14 A H2' H 1 4.601 0.001 . 1 . . . A 14 A H2' . 17877 1 101 . 1 1 14 14 A H3' H 1 4.459 0.000 . 1 . . . A 14 A H3' . 17877 1 102 . 1 1 14 14 A H4' H 1 4.443 0.002 . 1 . . . A 14 A H4' . 17877 1 103 . 1 1 14 14 A H5' H 1 4.393 0.000 . 1 . . . A 14 A H5' . 17877 1 104 . 1 1 14 14 A H5'' H 1 4.168 0.000 . 1 . . . A 14 A H5'' . 17877 1 105 . 1 1 14 14 A H8 H 1 8.179 0.001 . 1 . . . A 14 A H8 . 17877 1 106 . 1 1 15 15 G H1' H 1 5.449 0.001 . 1 . . . A 15 G H1' . 17877 1 107 . 1 1 15 15 G H2' H 1 4.318 0.001 . 1 . . . A 15 G H2' . 17877 1 108 . 1 1 15 15 G H3' H 1 4.578 0.000 . 1 . . . A 15 G H3' . 17877 1 109 . 1 1 15 15 G H5'' H 1 4.333 0.000 . 1 . . . A 15 G H5'' . 17877 1 110 . 1 1 15 15 G H8 H 1 7.164 0.003 . 1 . . . A 15 G H8 . 17877 1 111 . 1 1 16 16 A H1' H 1 5.680 0.001 . 1 . . . A 16 A H1' . 17877 1 112 . 1 1 16 16 A H2 H 1 7.756 0.001 . 1 . . . A 16 A H2 . 17877 1 113 . 1 1 16 16 A H2' H 1 4.716 0.001 . 1 . . . A 16 A H2' . 17877 1 114 . 1 1 16 16 A H3' H 1 4.434 0.001 . 1 . . . A 16 A H3' . 17877 1 115 . 1 1 16 16 A H4' H 1 4.220 0.001 . 1 . . . A 16 A H4' . 17877 1 116 . 1 1 16 16 A H5' H 1 3.936 0.001 . 1 . . . A 16 A H5' . 17877 1 117 . 1 1 16 16 A H5'' H 1 3.923 0.000 . 1 . . . A 16 A H5'' . 17877 1 118 . 1 1 16 16 A H8 H 1 8.290 0.002 . 1 . . . A 16 A H8 . 17877 1 119 . 1 1 17 17 A H1' H 1 5.442 0.003 . 1 . . . A 17 A H1' . 17877 1 120 . 1 1 17 17 A H2 H 1 7.652 0.001 . 1 . . . A 17 A H2 . 17877 1 121 . 1 1 17 17 A H2' H 1 4.371 0.000 . 1 . . . A 17 A H2' . 17877 1 122 . 1 1 17 17 A H3' H 1 4.574 0.002 . 1 . . . A 17 A H3' . 17877 1 123 . 1 1 17 17 A H4' H 1 4.324 0.000 . 1 . . . A 17 A H4' . 17877 1 124 . 1 1 17 17 A H5'' H 1 3.923 0.000 . 1 . . . A 17 A H5'' . 17877 1 125 . 1 1 17 17 A H8 H 1 7.900 0.002 . 1 . . . A 17 A H8 . 17877 1 126 . 1 1 18 18 A H1' H 1 6.005 0.002 . 1 . . . A 18 A H1' . 17877 1 127 . 1 1 18 18 A H2 H 1 8.189 0.002 . 1 . . . A 18 A H2 . 17877 1 128 . 1 1 18 18 A H2' H 1 4.491 0.001 . 1 . . . A 18 A H2' . 17877 1 129 . 1 1 18 18 A H3' H 1 4.877 0.001 . 1 . . . A 18 A H3' . 17877 1 130 . 1 1 18 18 A H4' H 1 4.267 0.000 . 1 . . . A 18 A H4' . 17877 1 131 . 1 1 18 18 A H5' H 1 4.427 0.000 . 1 . . . A 18 A H5' . 17877 1 132 . 1 1 18 18 A H5'' H 1 4.233 0.000 . 1 . . . A 18 A H5'' . 17877 1 133 . 1 1 18 18 A H8 H 1 8.138 0.002 . 1 . . . A 18 A H8 . 17877 1 134 . 1 1 19 19 U H1' H 1 3.816 0.002 . 1 . . . A 19 U H1' . 17877 1 135 . 1 1 19 19 U H2' H 1 4.357 0.001 . 1 . . . A 19 U H2' . 17877 1 136 . 1 1 19 19 U H3' H 1 4.432 0.000 . 1 . . . A 19 U H3' . 17877 1 137 . 1 1 19 19 U H4' H 1 4.220 0.001 . 1 . . . A 19 U H4' . 17877 1 138 . 1 1 19 19 U H5 H 1 5.944 0.002 . 1 . . . A 19 U H5 . 17877 1 139 . 1 1 19 19 U H5' H 1 4.114 0.000 . 1 . . . A 19 U H5' . 17877 1 140 . 1 1 19 19 U H5'' H 1 4.194 0.001 . 1 . . . A 19 U H5'' . 17877 1 141 . 1 1 19 19 U H6 H 1 7.940 0.003 . 1 . . . A 19 U H6 . 17877 1 142 . 1 1 20 20 G H1' H 1 5.821 0.002 . 1 . . . A 20 G H1' . 17877 1 143 . 1 1 20 20 G H2' H 1 4.555 0.001 . 1 . . . A 20 G H2' . 17877 1 144 . 1 1 20 20 G H3' H 1 4.415 0.000 . 1 . . . A 20 G H3' . 17877 1 145 . 1 1 20 20 G H4' H 1 4.463 0.000 . 1 . . . A 20 G H4' . 17877 1 146 . 1 1 20 20 G H5' H 1 4.191 0.000 . 1 . . . A 20 G H5' . 17877 1 147 . 1 1 20 20 G H5'' H 1 4.062 0.002 . 1 . . . A 20 G H5'' . 17877 1 148 . 1 1 20 20 G H8 H 1 7.722 0.002 . 1 . . . A 20 G H8 . 17877 1 149 . 1 1 21 21 C H1' H 1 5.406 0.001 . 1 . . . A 21 C H1' . 17877 1 150 . 1 1 21 21 C H2' H 1 4.276 0.003 . 1 . . . A 21 C H2' . 17877 1 151 . 1 1 21 21 C H3' H 1 4.445 0.001 . 1 . . . A 21 C H3' . 17877 1 152 . 1 1 21 21 C H5 H 1 5.362 0.002 . 1 . . . A 21 C H5 . 17877 1 153 . 1 1 21 21 C H5' H 1 4.223 0.000 . 1 . . . A 21 C H5' . 17877 1 154 . 1 1 21 21 C H5'' H 1 4.175 0.000 . 1 . . . A 21 C H5'' . 17877 1 155 . 1 1 21 21 C H6 H 1 7.717 0.003 . 1 . . . A 21 C H6 . 17877 1 156 . 1 1 22 22 C H1' H 1 5.468 0.002 . 1 . . . A 22 C H1' . 17877 1 157 . 1 1 22 22 C H2' H 1 4.392 0.001 . 1 . . . A 22 C H2' . 17877 1 158 . 1 1 22 22 C H3' H 1 4.430 0.000 . 1 . . . A 22 C H3' . 17877 1 159 . 1 1 22 22 C H5 H 1 5.475 0.003 . 1 . . . A 22 C H5 . 17877 1 160 . 1 1 22 22 C H6 H 1 7.737 0.002 . 1 . . . A 22 C H6 . 17877 1 161 . 1 1 23 23 U H1' H 1 5.504 0.001 . 1 . . . A 23 U H1' . 17877 1 162 . 1 1 23 23 U H2' H 1 4.481 0.001 . 1 . . . A 23 U H2' . 17877 1 163 . 1 1 23 23 U H3' H 1 4.497 0.002 . 1 . . . A 23 U H3' . 17877 1 164 . 1 1 23 23 U H4' H 1 4.431 0.000 . 1 . . . A 23 U H4' . 17877 1 165 . 1 1 23 23 U H5 H 1 5.386 0.003 . 1 . . . A 23 U H5 . 17877 1 166 . 1 1 23 23 U H5'' H 1 4.082 0.000 . 1 . . . A 23 U H5'' . 17877 1 167 . 1 1 23 23 U H6 H 1 7.869 0.003 . 1 . . . A 23 U H6 . 17877 1 168 . 1 1 24 24 U H1' H 1 5.571 0.002 . 1 . . . A 24 U H1' . 17877 1 169 . 1 1 24 24 U H2' H 1 4.512 0.002 . 1 . . . A 24 U H2' . 17877 1 170 . 1 1 24 24 U H3' H 1 4.626 0.001 . 1 . . . A 24 U H3' . 17877 1 171 . 1 1 24 24 U H5 H 1 5.608 0.003 . 1 . . . A 24 U H5 . 17877 1 172 . 1 1 24 24 U H5'' H 1 4.151 0.000 . 1 . . . A 24 U H5'' . 17877 1 173 . 1 1 24 24 U H6 H 1 7.994 0.003 . 1 . . . A 24 U H6 . 17877 1 174 . 1 1 25 25 A H1' H 1 5.931 0.001 . 1 . . . A 25 A H1' . 17877 1 175 . 1 1 25 25 A H2 H 1 6.974 0.002 . 1 . . . A 25 A H2 . 17877 1 176 . 1 1 25 25 A H2' H 1 4.422 0.001 . 1 . . . A 25 A H2' . 17877 1 177 . 1 1 25 25 A H3' H 1 4.654 0.003 . 1 . . . A 25 A H3' . 17877 1 178 . 1 1 25 25 A H4' H 1 4.638 0.001 . 1 . . . A 25 A H4' . 17877 1 179 . 1 1 25 25 A H5' H 1 4.229 0.000 . 1 . . . A 25 A H5' . 17877 1 180 . 1 1 25 25 A H5'' H 1 4.179 0.000 . 1 . . . A 25 A H5'' . 17877 1 181 . 1 1 25 25 A H8 H 1 8.188 0.002 . 1 . . . A 25 A H8 . 17877 1 182 . 1 1 26 26 U H1' H 1 5.402 0.002 . 1 . . . A 26 U H1' . 17877 1 183 . 1 1 26 26 U H2' H 1 4.277 0.003 . 1 . . . A 26 U H2' . 17877 1 184 . 1 1 26 26 U H3' H 1 4.390 0.000 . 1 . . . A 26 U H3' . 17877 1 185 . 1 1 26 26 U H5 H 1 4.954 0.001 . 1 . . . A 26 U H5 . 17877 1 186 . 1 1 26 26 U H5'' H 1 4.065 0.000 . 1 . . . A 26 U H5'' . 17877 1 187 . 1 1 26 26 U H6 H 1 7.610 0.003 . 1 . . . A 26 U H6 . 17877 1 188 . 1 1 27 27 C H1' H 1 5.541 0.001 . 1 . . . A 27 C H1' . 17877 1 189 . 1 1 27 27 C H2' H 1 4.493 0.002 . 1 . . . A 27 C H2' . 17877 1 190 . 1 1 27 27 C H3' H 1 4.589 0.000 . 1 . . . A 27 C H3' . 17877 1 191 . 1 1 27 27 C H4' H 1 4.234 0.000 . 1 . . . A 27 C H4' . 17877 1 192 . 1 1 27 27 C H5 H 1 5.508 0.001 . 1 . . . A 27 C H5 . 17877 1 193 . 1 1 27 27 C H5' H 1 4.089 0.000 . 1 . . . A 27 C H5' . 17877 1 194 . 1 1 27 27 C H5'' H 1 4.028 0.000 . 1 . . . A 27 C H5'' . 17877 1 195 . 1 1 27 27 C H6 H 1 7.740 0.003 . 1 . . . A 27 C H6 . 17877 1 196 . 1 1 28 28 G H1' H 1 5.656 0.003 . 1 . . . A 28 G H1' . 17877 1 197 . 1 1 28 28 G H2' H 1 4.655 0.000 . 1 . . . A 28 G H2' . 17877 1 198 . 1 1 28 28 G H3' H 1 4.431 0.001 . 1 . . . A 28 G H3' . 17877 1 199 . 1 1 28 28 G H4' H 1 4.382 0.000 . 1 . . . A 28 G H4' . 17877 1 200 . 1 1 28 28 G H5'' H 1 4.076 0.000 . 1 . . . A 28 G H5'' . 17877 1 201 . 1 1 28 28 G H8 H 1 7.511 0.003 . 1 . . . A 28 G H8 . 17877 1 202 . 1 1 29 29 G H1' H 1 5.718 0.001 . 1 . . . A 29 G H1' . 17877 1 203 . 1 1 29 29 G H2' H 1 4.457 0.002 . 1 . . . A 29 G H2' . 17877 1 204 . 1 1 29 29 G H3' H 1 4.502 0.000 . 1 . . . A 29 G H3' . 17877 1 205 . 1 1 29 29 G H4' H 1 4.490 0.002 . 1 . . . A 29 G H4' . 17877 1 206 . 1 1 29 29 G H5' H 1 4.073 0.000 . 1 . . . A 29 G H5' . 17877 1 207 . 1 1 29 29 G H5'' H 1 4.052 0.000 . 1 . . . A 29 G H5'' . 17877 1 208 . 1 1 29 29 G H8 H 1 7.238 0.002 . 1 . . . A 29 G H8 . 17877 1 209 . 1 1 30 30 U H1' H 1 5.566 0.001 . 1 . . . A 30 U H1' . 17877 1 210 . 1 1 30 30 U H2' H 1 4.518 0.001 . 1 . . . A 30 U H2' . 17877 1 211 . 1 1 30 30 U H3' H 1 4.429 0.001 . 1 . . . A 30 U H3' . 17877 1 212 . 1 1 30 30 U H4' H 1 4.276 0.000 . 1 . . . A 30 U H4' . 17877 1 213 . 1 1 30 30 U H5 H 1 5.040 0.003 . 1 . . . A 30 U H5 . 17877 1 214 . 1 1 30 30 U H5' H 1 4.167 0.000 . 1 . . . A 30 U H5' . 17877 1 215 . 1 1 30 30 U H5'' H 1 4.082 0.000 . 1 . . . A 30 U H5'' . 17877 1 216 . 1 1 30 30 U H6 H 1 7.773 0.002 . 1 . . . A 30 U H6 . 17877 1 217 . 1 1 31 31 C H1' H 1 5.603 0.003 . 1 . . . A 31 C H1' . 17877 1 218 . 1 1 31 31 C H2' H 1 4.258 0.001 . 1 . . . A 31 C H2' . 17877 1 219 . 1 1 31 31 C H3' H 1 4.351 0.000 . 1 . . . A 31 C H3' . 17877 1 220 . 1 1 31 31 C H4' H 1 4.280 0.000 . 1 . . . A 31 C H4' . 17877 1 221 . 1 1 31 31 C H5 H 1 5.654 0.001 . 1 . . . A 31 C H5 . 17877 1 222 . 1 1 31 31 C H5' H 1 4.120 0.000 . 1 . . . A 31 C H5' . 17877 1 223 . 1 1 31 31 C H5'' H 1 4.069 0.000 . 1 . . . A 31 C H5'' . 17877 1 224 . 1 1 31 31 C H6 H 1 7.891 0.002 . 1 . . . A 31 C H6 . 17877 1 225 . 1 1 32 32 C H1' H 1 5.732 0.000 . 1 . . . A 32 C H1' . 17877 1 226 . 1 1 32 32 C H2' H 1 3.982 0.001 . 1 . . . A 32 C H2' . 17877 1 227 . 1 1 32 32 C H3' H 1 4.167 0.002 . 1 . . . A 32 C H3' . 17877 1 228 . 1 1 32 32 C H4' H 1 4.146 0.000 . 1 . . . A 32 C H4' . 17877 1 229 . 1 1 32 32 C H5 H 1 5.534 0.002 . 1 . . . A 32 C H5 . 17877 1 230 . 1 1 32 32 C H5' H 1 4.099 0.000 . 1 . . . A 32 C H5' . 17877 1 231 . 1 1 32 32 C H5'' H 1 4.021 0.001 . 1 . . . A 32 C H5'' . 17877 1 232 . 1 1 32 32 C H6 H 1 7.680 0.003 . 1 . . . A 32 C H6 . 17877 1 stop_ save_