data_17921 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 17921 _Entry.Title ; Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant. ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2011-09-06 _Entry.Accession_date 2011-09-06 _Entry.Last_release_date 2012-02-08 _Entry.Original_release_date 2012-02-08 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Details 'This entry details the partial chemical shift assignments for a 47-mer RNA construct monomer variant derived from the 30kDa GAAA-tetraloop receptor homodimer complex.' _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 Kirk 'Vander Muelen' . A . 17921 2 Jared Davis . H. . 17921 3 Lawrence Clos . J. II 17921 4 Samuel Butcher . E. . 17921 stop_ loop_ _Entry_src.ID _Entry_src.Project_name _Entry_src.Organization_full_name _Entry_src.Organization_initials _Entry_src.Entry_ID 1 . 'Butcher Group; Dept. of Biochemistry, University of Wisconsin - Madison' . 17921 2 . 'Nuclear Magnetic Resonance Facility at Madison' . 17921 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 17921 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '15N chemical shifts' 22 17921 '1H chemical shifts' 32 17921 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2012-02-08 2011-09-06 original author . 17921 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 6652 'GAAA tetraloop/Receptor homodimer' 17921 PDB 2ADT 'NMR structure of a 30 kDa GAAA tetraloop receptor complex' 17921 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 17921 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID . _Citation.Full_citation . _Citation.Title 'Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant.' _Citation.Status 'in preparation' _Citation.Type 'BMRB only' _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Kirk 'Vander Muelen' . A . 17921 1 2 Jared Davis . H. . 17921 1 3 Lawrence Clos . J. II 17921 1 4 Samuel Butcher . E. . 17921 1 stop_ loop_ _Citation_keyword.Keyword _Citation_keyword.Entry_ID _Citation_keyword.Citation_ID 'GAAA tetraloop receptor' 17921 1 RNA 17921 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 17921 _Assembly.ID 1 _Assembly.Name 'GAAA tetraloop monomer' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'GAAA tetraloop monomer' 1 $TECTO47 A . yes native no no . . . 17921 1 stop_ loop_ _Assembly_db_link.Author_supplied _Assembly_db_link.Database_code _Assembly_db_link.Accession_code _Assembly_db_link.Entry_mol_code _Assembly_db_link.Entry_mol_name _Assembly_db_link.Entry_experimental_method _Assembly_db_link.Entry_structure_resolution _Assembly_db_link.Entry_relation_type _Assembly_db_link.Entry_details _Assembly_db_link.Entry_ID _Assembly_db_link.Assembly_ID yes BMRB 6652 . . 'solution NMR' . homodimer . 17921 1 yes PDB 2ADT . . 'solution NMR' . homodimer . 17921 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_TECTO47 _Entity.Sf_category entity _Entity.Sf_framecode TECTO47 _Entity.Entry_ID 17921 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name TECTO47 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAGGAUAUGGAAGAACCGG GGUGACUUGGUUCUUCCUAA GUCCUCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 47 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 17921 1 2 . G . 17921 1 3 . A . 17921 1 4 . G . 17921 1 5 . G . 17921 1 6 . A . 17921 1 7 . U . 17921 1 8 . A . 17921 1 9 . U . 17921 1 10 . G . 17921 1 11 . G . 17921 1 12 . A . 17921 1 13 . A . 17921 1 14 . G . 17921 1 15 . A . 17921 1 16 . A . 17921 1 17 . C . 17921 1 18 . C . 17921 1 19 . G . 17921 1 20 . G . 17921 1 21 . G . 17921 1 22 . G . 17921 1 23 . U . 17921 1 24 . G . 17921 1 25 . A . 17921 1 26 . C . 17921 1 27 . U . 17921 1 28 . U . 17921 1 29 . G . 17921 1 30 . G . 17921 1 31 . U . 17921 1 32 . U . 17921 1 33 . C . 17921 1 34 . U . 17921 1 35 . U . 17921 1 36 . C . 17921 1 37 . C . 17921 1 38 . U . 17921 1 39 . A . 17921 1 40 . A . 17921 1 41 . G . 17921 1 42 . U . 17921 1 43 . C . 17921 1 44 . C . 17921 1 45 . U . 17921 1 46 . C . 17921 1 47 . C . 17921 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 17921 1 . G 2 2 17921 1 . A 3 3 17921 1 . G 4 4 17921 1 . G 5 5 17921 1 . A 6 6 17921 1 . U 7 7 17921 1 . A 8 8 17921 1 . U 9 9 17921 1 . G 10 10 17921 1 . G 11 11 17921 1 . A 12 12 17921 1 . A 13 13 17921 1 . G 14 14 17921 1 . A 15 15 17921 1 . A 16 16 17921 1 . C 17 17 17921 1 . C 18 18 17921 1 . G 19 19 17921 1 . G 20 20 17921 1 . G 21 21 17921 1 . G 22 22 17921 1 . U 23 23 17921 1 . G 24 24 17921 1 . A 25 25 17921 1 . C 26 26 17921 1 . U 27 27 17921 1 . U 28 28 17921 1 . G 29 29 17921 1 . G 30 30 17921 1 . U 31 31 17921 1 . U 32 32 17921 1 . C 33 33 17921 1 . U 34 34 17921 1 . U 35 35 17921 1 . C 36 36 17921 1 . C 37 37 17921 1 . U 38 38 17921 1 . A 39 39 17921 1 . A 40 40 17921 1 . G 41 41 17921 1 . U 42 42 17921 1 . C 43 43 17921 1 . C 44 44 17921 1 . U 45 45 17921 1 . C 46 46 17921 1 . C 47 47 17921 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 17921 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $TECTO47 . . 'no natural source' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17921 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 17921 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $TECTO47 . 'enzymatic semisynthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17921 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_unlabeled _Sample.Sf_category sample _Sample.Sf_framecode sample_unlabeled _Sample.Entry_ID 17921 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 TECTO47 'natural abundance' . . 1 $TECTO47 . . 1 . . mM . . . . 17921 1 2 DTT 'natural abundance' . . . . . . 10 . . uM . . . . 17921 1 3 'potassium phosphate' 'natural abundance' . . . . . . 15 . . mM . . . . 17921 1 4 H2O 'natural abundance' . . . . . . 90 . . % . . . . 17921 1 5 D2O 'natural abundance' . . . . . . 10 . . % . . . . 17921 1 stop_ save_ save_sample_labeled _Sample.Sf_category sample _Sample.Sf_framecode sample_labeled _Sample.Entry_ID 17921 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 TECTO47 '[U-100% 13C; U-100% 15N]' . . 1 $TECTO47 . . 1 . . mM . . . . 17921 2 2 DTT 'natural abundance' . . . . . . 10 . . uM . . . . 17921 2 3 'potassium phosphate' 'natural abundance' . . . . . . 15 . . mM . . . . 17921 2 4 H2O 'natural abundance' . . . . . . 90 . . % . . . . 17921 2 5 D2O 'natural abundance' . . . . . . 10 . . % . . . . 17921 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 17921 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 15 . mM 17921 1 pH 7.0 . pH 17921 1 pressure 1 . atm 17921 1 temperature 283 . K 17921 1 stop_ save_ ############################ # Computer software used # ############################ save_xwinnmr _Software.Sf_category software _Software.Sf_framecode xwinnmr _Software.Entry_ID 17921 _Software.ID 1 _Software.Name xwinnmr _Software.Version 3.5 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 17921 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID collection 17921 1 processing 17921 1 stop_ save_ save_SPARKY _Software.Sf_category software _Software.Sf_framecode SPARKY _Software.Entry_ID 17921 _Software.ID 2 _Software.Name SPARKY _Software.Version 3.114 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 17921 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 17921 2 'data analysis' 17921 2 'peak picking' 17921 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 17921 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_2 _NMR_spectrometer.Entry_ID 17921 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model DMX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 750 save_ save_spectrometer_3 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_3 _NMR_spectrometer.Entry_ID 17921 _NMR_spectrometer.ID 3 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Varian _NMR_spectrometer.Model INOVA _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 900 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 17921 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 600 . . . 17921 1 2 spectrometer_2 Bruker DMX . 750 . . . 17921 1 3 spectrometer_3 Varian INOVA . 900 . . . 17921 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 17921 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-15N HSQC' no . . . . . . . . . . 2 $sample_labeled isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 17921 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_unlabeled isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 17921 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 17921 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . . . . . 17921 1 N 15 DSS 'methyl protons' . . . . ppm 0.00 na indirect 0.101329118 . . . . . . . . . 17921 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 17921 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-15N HSQC' . . . 17921 1 2 '2D 1H-1H NOESY' . . . 17921 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 2 2 G H1 H 1 12.323 0.000 . 1 . . . . 2 G H1 . 17921 1 2 . 1 1 2 2 G N1 N 15 146.968 0.000 . 1 . . . . 2 G N1 . 17921 1 3 . 1 1 3 3 A H2 H 1 7.391 0.000 . 1 . . . . 3 A H2 . 17921 1 4 . 1 1 4 4 G H1 H 1 12.683 0.000 . 1 . . . . 4 G H1 . 17921 1 5 . 1 1 4 4 G N1 N 15 147.204 0.000 . 1 . . . . 4 G N1 . 17921 1 6 . 1 1 5 5 G H1 H 1 12.286 0.000 . 1 . . . . 5 G H1 . 17921 1 7 . 1 1 5 5 G N1 N 15 147.086 0.000 . 1 . . . . 5 G N1 . 17921 1 8 . 1 1 6 6 A H2 H 1 7.393 0.001 . 1 . . . . 6 A H2 . 17921 1 9 . 1 1 7 7 U H3 H 1 12.547 0.001 . 1 . . . . 7 U H3 . 17921 1 10 . 1 1 9 9 U H3 H 1 11.048 0.000 . 1 . . . . 9 U H3 . 17921 1 11 . 1 1 10 10 G H1 H 1 12.394 0.002 . 1 . . . . 10 G H1 . 17921 1 12 . 1 1 10 10 G N1 N 15 147.199 0.000 . 1 . . . . 10 G N1 . 17921 1 13 . 1 1 11 11 G H1 H 1 12.001 0.000 . 1 . . . . 11 G H1 . 17921 1 14 . 1 1 11 11 G N1 N 15 147.024 0.000 . 1 . . . . 11 G N1 . 17921 1 15 . 1 1 12 12 A H2 H 1 7.027 0.000 . 1 . . . . 12 A H2 . 17921 1 16 . 1 1 13 13 A H2 H 1 7.336 0.000 . 1 . . . . 13 A H2 . 17921 1 17 . 1 1 14 14 G H1 H 1 12.403 0.004 . 1 . . . . 14 G H1 . 17921 1 18 . 1 1 14 14 G N1 N 15 146.722 0.000 . 1 . . . . 14 G N1 . 17921 1 19 . 1 1 15 15 A H2 H 1 7.038 0.000 . 1 . . . . 15 A H2 . 17921 1 20 . 1 1 16 16 A H2 H 1 7.716 0.000 . 1 . . . . 16 A H2 . 17921 1 21 . 1 1 19 19 G H1 H 1 10.138 0.000 . 1 . . . . 19 G H1 . 17921 1 22 . 1 1 19 19 G N1 N 15 142.425 0.000 . 1 . . . . 19 G N1 . 17921 1 23 . 1 1 20 20 G H1 H 1 11.054 0.001 . 1 . . . . 20 G H1 . 17921 1 24 . 1 1 20 20 G N1 N 15 143.416 0.000 . 1 . . . . 20 G N1 . 17921 1 25 . 1 1 21 21 G H1 H 1 13.137 0.000 . 1 . . . . 21 G H1 . 17921 1 26 . 1 1 21 21 G H21 H 1 9.048 0.005 . 2 . . . . 21 G H21 . 17921 1 27 . 1 1 21 21 G H22 H 1 8.524 0.001 . 2 . . . . 21 G H22 . 17921 1 28 . 1 1 21 21 G N1 N 15 147.610 0.000 . 1 . . . . 21 G N1 . 17921 1 29 . 1 1 22 22 G H1 H 1 10.810 0.001 . 1 . . . . 22 G H1 . 17921 1 30 . 1 1 22 22 G N1 N 15 145.946 0.000 . 1 . . . . 22 G N1 . 17921 1 31 . 1 1 27 27 U H3 H 1 11.784 0.000 . 1 . . . . 27 U H3 . 17921 1 32 . 1 1 27 27 U N3 N 15 157.764 0.000 . 1 . . . . 27 U N3 . 17921 1 33 . 1 1 28 28 U H3 H 1 11.971 0.002 . 1 . . . . 28 U H3 . 17921 1 34 . 1 1 28 28 U N3 N 15 158.591 0.000 . 1 . . . . 28 U N3 . 17921 1 35 . 1 1 29 29 G H1 H 1 12.266 0.000 . 1 . . . . 29 G H1 . 17921 1 36 . 1 1 29 29 G N1 N 15 147.083 0.000 . 1 . . . . 29 G N1 . 17921 1 37 . 1 1 30 30 G H1 H 1 13.249 0.000 . 1 . . . . 30 G H1 . 17921 1 38 . 1 1 30 30 G N1 N 15 148.255 0.000 . 1 . . . . 30 G N1 . 17921 1 39 . 1 1 31 31 U H3 H 1 14.314 0.001 . 1 . . . . 31 U H3 . 17921 1 40 . 1 1 31 31 U N3 N 15 162.458 0.000 . 1 . . . . 31 U N3 . 17921 1 41 . 1 1 32 32 U H3 H 1 13.787 0.001 . 1 . . . . 32 U H3 . 17921 1 42 . 1 1 32 32 U N3 N 15 162.179 0.000 . 1 . . . . 32 U N3 . 17921 1 43 . 1 1 34 34 U H3 H 1 13.785 0.000 . 1 . . . . 34 U H3 . 17921 1 44 . 1 1 34 34 U N3 N 15 162.990 0.000 . 1 . . . . 34 U N3 . 17921 1 45 . 1 1 35 35 U H3 H 1 13.730 0.000 . 1 . . . . 35 U H3 . 17921 1 46 . 1 1 35 35 U N3 N 15 162.986 0.000 . 1 . . . . 35 U N3 . 17921 1 47 . 1 1 38 38 U H3 H 1 11.046 0.000 . 1 . . . . 38 U H3 . 17921 1 48 . 1 1 38 38 U N3 N 15 157.251 0.000 . 1 . . . . 38 U N3 . 17921 1 49 . 1 1 41 41 G H1 H 1 12.129 0.000 . 1 . . . . 41 G H1 . 17921 1 50 . 1 1 41 41 G N1 N 15 147.048 0.000 . 1 . . . . 41 G N1 . 17921 1 51 . 1 1 42 42 U H3 H 1 13.959 0.004 . 1 . . . . 42 U H3 . 17921 1 52 . 1 1 42 42 U N3 N 15 162.751 0.000 . 1 . . . . 42 U N3 . 17921 1 53 . 1 1 45 45 U H3 H 1 13.966 0.000 . 1 . . . . 45 U H3 . 17921 1 54 . 1 1 45 45 U N3 N 15 162.656 0.000 . 1 . . . . 45 U N3 . 17921 1 stop_ save_