data_19278 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 19278 _Entry.Title ; Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2013-05-30 _Entry.Accession_date 2013-05-30 _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 'Kah Wai' Lim . . . 19278 2 'Anh Tuan' Phan . . . 19278 stop_ loop_ _SG_project.SG_project_ID _SG_project.Project_name _SG_project.Full_name_of_center _SG_project.Initial_of_center _SG_project.Entry_ID 1 'not applicable' 'not applicable' . 19278 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 19278 duplex . 19278 'duplex-quadruplex hybrid' . 19278 quadruplex . 19278 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 19278 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 266 19278 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2013-10-09 2013-05-30 update BMRB 'update entry citation' 19278 1 . . 2013-07-08 2013-05-30 original author 'original release' 19278 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 19276 'd[CGCGAAGCATTCGCG] hairpin' 19278 BMRB 19277 'd[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid' 19278 BMRB 19279 'd[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid' 19278 BMRB 19280 'd[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid' 19278 BMRB 19281 'd[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid' 19278 stop_ save_ ############### # Citations # ############### save_Citation_1 _Citation.Sf_category citations _Citation.Sf_framecode Citation_1 _Citation.Entry_ID 19278 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 23794476 _Citation.Full_citation . _Citation.Title 'Structural basis of DNA quadruplex-duplex junction formation.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Angew. Chem. Int. Ed. Engl.' _Citation.Journal_name_full 'Angewandte Chemie (International ed. in English)' _Citation.Journal_volume 52 _Citation.Journal_issue 33 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 8566 _Citation.Page_last 8569 _Citation.Year 2013 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 'Kah Wai' Lim . . . 19278 1 2 'Anh Tuan' Phan . . . 19278 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 19278 _Assembly.ID 1 _Assembly.Name 'd[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'DNA (32-MER)' 1 $DNA_(32-MER) A . yes native no no . . . 19278 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_DNA_(32-MER) _Entity.Sf_category entity _Entity.Sf_framecode DNA_(32-MER) _Entity.Entry_ID 19278 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name DNA_(32-MER) _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GCGCGAAGCATTCGCGGGGA GGTGGGGAAGGG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 32 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 10118.558 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DG . 19278 1 2 . DC . 19278 1 3 . DG . 19278 1 4 . DC . 19278 1 5 . DG . 19278 1 6 . DA . 19278 1 7 . DA . 19278 1 8 . DG . 19278 1 9 . DC . 19278 1 10 . DA . 19278 1 11 . DT . 19278 1 12 . DT . 19278 1 13 . DC . 19278 1 14 . DG . 19278 1 15 . DC . 19278 1 16 . DG . 19278 1 17 . DG . 19278 1 18 . DG . 19278 1 19 . DG . 19278 1 20 . DA . 19278 1 21 . DG . 19278 1 22 . DG . 19278 1 23 . DT . 19278 1 24 . DG . 19278 1 25 . DG . 19278 1 26 . DG . 19278 1 27 . DG . 19278 1 28 . DA . 19278 1 29 . DA . 19278 1 30 . DG . 19278 1 31 . DG . 19278 1 32 . DG . 19278 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 19278 1 . DC 2 2 19278 1 . DG 3 3 19278 1 . DC 4 4 19278 1 . DG 5 5 19278 1 . DA 6 6 19278 1 . DA 7 7 19278 1 . DG 8 8 19278 1 . DC 9 9 19278 1 . DA 10 10 19278 1 . DT 11 11 19278 1 . DT 12 12 19278 1 . DC 13 13 19278 1 . DG 14 14 19278 1 . DC 15 15 19278 1 . DG 16 16 19278 1 . DG 17 17 19278 1 . DG 18 18 19278 1 . DG 19 19 19278 1 . DA 20 20 19278 1 . DG 21 21 19278 1 . DG 22 22 19278 1 . DT 23 23 19278 1 . DG 24 24 19278 1 . DG 25 25 19278 1 . DG 26 26 19278 1 . DG 27 27 19278 1 . DA 28 28 19278 1 . DA 29 29 19278 1 . DG 30 30 19278 1 . DG 31 31 19278 1 . DG 32 32 19278 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 19278 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $DNA_(32-MER) . . 'no natural source' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19278 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 19278 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $DNA_(32-MER) . 'chemical synthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19278 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_DNA-1 _Sample.Sf_category sample _Sample.Sf_framecode DNA-1 _Sample.Entry_ID 19278 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (32-MER)' 'natural abundance' . . 1 $DNA_(32-MER) . . 0.5-2.0 . . mM . . . . 19278 1 2 H2O 'natural abundance' . . . . . . 90 . . % . . . . 19278 1 3 D2O 'natural abundance' . . . . . . 10 . . % . . . . 19278 1 stop_ save_ save_DNA-2 _Sample.Sf_category sample _Sample.Sf_framecode DNA-2 _Sample.Entry_ID 19278 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (32-MER)' 'natural abundance' . . 1 $DNA_(32-MER) . . 0.5-2.0 . . mM . . . . 19278 2 2 D2O 'natural abundance' . . . . . . 100 . . % . . . . 19278 2 stop_ save_ save_DNA-3 _Sample.Sf_category sample _Sample.Sf_framecode DNA-3 _Sample.Entry_ID 19278 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (32-MER)' '[U-2% 15N]' . . 1 $DNA_(32-MER) . . 0.5-2.0 . . mM . . . . 19278 3 2 H2O 'natural abundance' . . . . . . 90 . . % . . . . 19278 3 3 D2O 'natural abundance' . . . . . . 10 . . % . . . . 19278 3 stop_ save_ save_DNA-4 _Sample.Sf_category sample _Sample.Sf_framecode DNA-4 _Sample.Entry_ID 19278 _Sample.ID 4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (32-MER)' '[U-100% 2H]' . . 1 $DNA_(32-MER) . . 0.5-2.0 . . mM . . . . 19278 4 2 D2O 'natural abundance' . . . . . . 100 . . % . . . . 19278 4 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 19278 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 40 . mM 19278 1 pH 7 . pH 19278 1 pressure 1 . atm 19278 1 temperature 298 . K 19278 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 19278 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 40 . mM 19278 2 pH 7 . pH 19278 2 pressure 1 . atm 19278 2 temperature 278 . K 19278 2 stop_ save_ ############################ # Computer software used # ############################ save_TOPSPIN _Software.Sf_category software _Software.Sf_framecode TOPSPIN _Software.Entry_ID 19278 _Software.ID 1 _Software.Name TOPSPIN _Software.Version 2.1 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 19278 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID processing 19278 1 stop_ save_ save_Felix _Software.Sf_category software _Software.Sf_framecode Felix _Software.Entry_ID 19278 _Software.ID 2 _Software.Name FELIX _Software.Version 2007 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Felix NMR, Inc.' . . 19278 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'peak picking' 19278 2 stop_ save_ save_X-PLOR_NIH _Software.Sf_category software _Software.Sf_framecode X-PLOR_NIH _Software.Entry_ID 19278 _Software.ID 3 _Software.Name 'X-PLOR NIH' _Software.Version 2.29 _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 19278 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 19278 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_1 _NMR_spectrometer.Entry_ID 19278 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 400 save_ save_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_2 _NMR_spectrometer.Entry_ID 19278 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_spectrometer_3 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode spectrometer_3 _NMR_spectrometer.Entry_ID 19278 _NMR_spectrometer.ID 3 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 19278 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 spectrometer_1 Bruker Avance . 400 . . . 19278 1 2 spectrometer_2 Bruker Avance . 600 . . . 19278 1 3 spectrometer_3 Bruker Avance . 700 . . . 19278 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 19278 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 2 $DNA-2 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 2 '2D 1H-1H JR NOESY' no . . . . . . . . . . 1 $DNA-1 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 3 '2D 1H-1H JR NOESY' no . . . . . . . . . . 1 $DNA-1 isotropic . . 2 $sample_conditions_2 . . . . . . . . . . . . . . . . . . . . . 19278 1 4 '2D 1H-1H COSY' no . . . . . . . . . . 2 $DNA-2 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 5 '2D 1H-1H TOCSY' no . . . . . . . . . . 2 $DNA-2 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 6 '2D 1H-13C HSQC' no . . . . . . . . . . 2 $DNA-2 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 7 '2D 1H-13C JR HMBC' no . . . . . . . . . . 1 $DNA-1 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 8 '2D 1H-31P HSQC' no . . . . . . . . . . 2 $DNA-2 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 9 'H-D EXCHANGE' no . . . . . . . . . . 2 $DNA-2 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 10 15N-FILTERED no . . . . . . . . . . 3 $DNA-3 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 11 D-LABELED no . . . . . . . . . . 4 $DNA-4 isotropic . . 1 $sample_conditions_1 . . . . . . . . . . . . . . . . . . . . . 19278 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_1 _Chem_shift_reference.Entry_ID 19278 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . . . . . 19278 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chem_shift_list_1 _Assigned_chem_shift_list.Entry_ID 19278 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 19278 1 2 '2D 1H-1H JR NOESY' . . . 19278 1 10 15N-FILTERED . . . 19278 1 11 D-LABELED . . . 19278 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 DG H1 H 1 11.758 0.010 . 1 . . . A 1 DG H1 . 19278 1 2 . 1 1 1 1 DG H1' H 1 4.538 0.010 . 1 . . . A 1 DG H1' . 19278 1 3 . 1 1 1 1 DG H2' H 1 2.220 0.010 . 1 . . . A 1 DG H2' . 19278 1 4 . 1 1 1 1 DG H2'' H 1 2.467 0.010 . 1 . . . A 1 DG H2'' . 19278 1 5 . 1 1 1 1 DG H3' H 1 4.801 0.010 . 1 . . . A 1 DG H3' . 19278 1 6 . 1 1 1 1 DG H4' H 1 4.452 0.010 . 1 . . . A 1 DG H4' . 19278 1 7 . 1 1 1 1 DG H5' H 1 4.483 0.010 . 2 . . . A 1 DG H5' . 19278 1 8 . 1 1 1 1 DG H5'' H 1 3.867 0.010 . 2 . . . A 1 DG H5'' . 19278 1 9 . 1 1 1 1 DG H8 H 1 6.234 0.010 . 1 . . . A 1 DG H8 . 19278 1 10 . 1 1 2 2 DC H1' H 1 5.588 0.010 . 1 . . . A 2 DC H1' . 19278 1 11 . 1 1 2 2 DC H2' H 1 1.676 0.010 . 1 . . . A 2 DC H2' . 19278 1 12 . 1 1 2 2 DC H2'' H 1 2.283 0.010 . 1 . . . A 2 DC H2'' . 19278 1 13 . 1 1 2 2 DC H3' H 1 4.735 0.010 . 1 . . . A 2 DC H3' . 19278 1 14 . 1 1 2 2 DC H4' H 1 3.476 0.010 . 1 . . . A 2 DC H4' . 19278 1 15 . 1 1 2 2 DC H5 H 1 5.206 0.010 . 1 . . . A 2 DC H5 . 19278 1 16 . 1 1 2 2 DC H5' H 1 4.024 0.010 . 2 . . . A 2 DC H5' . 19278 1 17 . 1 1 2 2 DC H5'' H 1 3.208 0.010 . 2 . . . A 2 DC H5'' . 19278 1 18 . 1 1 2 2 DC H6 H 1 6.962 0.010 . 1 . . . A 2 DC H6 . 19278 1 19 . 1 1 2 2 DC H41 H 1 8.444 0.010 . 1 . . . A 2 DC H41 . 19278 1 20 . 1 1 2 2 DC H42 H 1 6.395 0.010 . 1 . . . A 2 DC H42 . 19278 1 21 . 1 1 3 3 DG H1 H 1 12.867 0.010 . 1 . . . A 3 DG H1 . 19278 1 22 . 1 1 3 3 DG H1' H 1 5.868 0.010 . 1 . . . A 3 DG H1' . 19278 1 23 . 1 1 3 3 DG H2' H 1 2.647 0.010 . 1 . . . A 3 DG H2' . 19278 1 24 . 1 1 3 3 DG H2'' H 1 2.717 0.010 . 1 . . . A 3 DG H2'' . 19278 1 25 . 1 1 3 3 DG H3' H 1 4.994 0.010 . 1 . . . A 3 DG H3' . 19278 1 26 . 1 1 3 3 DG H4' H 1 4.419 0.010 . 1 . . . A 3 DG H4' . 19278 1 27 . 1 1 3 3 DG H8 H 1 7.882 0.010 . 1 . . . A 3 DG H8 . 19278 1 28 . 1 1 4 4 DC H1' H 1 5.608 0.010 . 1 . . . A 4 DC H1' . 19278 1 29 . 1 1 4 4 DC H2' H 1 1.836 0.010 . 1 . . . A 4 DC H2' . 19278 1 30 . 1 1 4 4 DC H2'' H 1 2.273 0.010 . 1 . . . A 4 DC H2'' . 19278 1 31 . 1 1 4 4 DC H3' H 1 4.805 0.010 . 1 . . . A 4 DC H3' . 19278 1 32 . 1 1 4 4 DC H4' H 1 4.119 0.010 . 1 . . . A 4 DC H4' . 19278 1 33 . 1 1 4 4 DC H5 H 1 5.347 0.010 . 1 . . . A 4 DC H5 . 19278 1 34 . 1 1 4 4 DC H6 H 1 7.236 0.010 . 1 . . . A 4 DC H6 . 19278 1 35 . 1 1 4 4 DC H41 H 1 8.239 0.010 . 1 . . . A 4 DC H41 . 19278 1 36 . 1 1 4 4 DC H42 H 1 6.341 0.010 . 1 . . . A 4 DC H42 . 19278 1 37 . 1 1 5 5 DG H1 H 1 12.733 0.010 . 1 . . . A 5 DG H1 . 19278 1 38 . 1 1 5 5 DG H1' H 1 5.373 0.010 . 1 . . . A 5 DG H1' . 19278 1 39 . 1 1 5 5 DG H2' H 1 2.605 0.010 . 1 . . . A 5 DG H2' . 19278 1 40 . 1 1 5 5 DG H2'' H 1 2.685 0.010 . 1 . . . A 5 DG H2'' . 19278 1 41 . 1 1 5 5 DG H3' H 1 4.952 0.010 . 1 . . . A 5 DG H3' . 19278 1 42 . 1 1 5 5 DG H4' H 1 4.257 0.010 . 1 . . . A 5 DG H4' . 19278 1 43 . 1 1 5 5 DG H8 H 1 7.834 0.010 . 1 . . . A 5 DG H8 . 19278 1 44 . 1 1 6 6 DA H1' H 1 5.881 0.010 . 1 . . . A 6 DA H1' . 19278 1 45 . 1 1 6 6 DA H2 H 1 7.568 0.010 . 1 . . . A 6 DA H2 . 19278 1 46 . 1 1 6 6 DA H2' H 1 2.287 0.010 . 1 . . . A 6 DA H2' . 19278 1 47 . 1 1 6 6 DA H2'' H 1 2.601 0.010 . 1 . . . A 6 DA H2'' . 19278 1 48 . 1 1 6 6 DA H3' H 1 4.955 0.010 . 1 . . . A 6 DA H3' . 19278 1 49 . 1 1 6 6 DA H4' H 1 4.286 0.010 . 1 . . . A 6 DA H4' . 19278 1 50 . 1 1 6 6 DA H8 H 1 7.897 0.010 . 1 . . . A 6 DA H8 . 19278 1 51 . 1 1 7 7 DA H1' H 1 5.887 0.010 . 1 . . . A 7 DA H1' . 19278 1 52 . 1 1 7 7 DA H2 H 1 7.693 0.010 . 1 . . . A 7 DA H2 . 19278 1 53 . 1 1 7 7 DA H2' H 1 2.057 0.010 . 1 . . . A 7 DA H2' . 19278 1 54 . 1 1 7 7 DA H2'' H 1 2.432 0.010 . 1 . . . A 7 DA H2'' . 19278 1 55 . 1 1 7 7 DA H3' H 1 4.878 0.010 . 1 . . . A 7 DA H3' . 19278 1 56 . 1 1 7 7 DA H4' H 1 4.341 0.010 . 1 . . . A 7 DA H4' . 19278 1 57 . 1 1 7 7 DA H8 H 1 7.450 0.010 . 1 . . . A 7 DA H8 . 19278 1 58 . 1 1 8 8 DG H1' H 1 5.400 0.010 . 1 . . . A 8 DG H1' . 19278 1 59 . 1 1 8 8 DG H2' H 1 2.628 0.010 . 1 . . . A 8 DG H2' . 19278 1 60 . 1 1 8 8 DG H2'' H 1 2.350 0.010 . 1 . . . A 8 DG H2'' . 19278 1 61 . 1 1 8 8 DG H3' H 1 4.809 0.010 . 1 . . . A 8 DG H3' . 19278 1 62 . 1 1 8 8 DG H4' H 1 4.369 0.010 . 1 . . . A 8 DG H4' . 19278 1 63 . 1 1 8 8 DG H8 H 1 8.032 0.010 . 1 . . . A 8 DG H8 . 19278 1 64 . 1 1 9 9 DC H1' H 1 5.708 0.010 . 1 . . . A 9 DC H1' . 19278 1 65 . 1 1 9 9 DC H2' H 1 1.598 0.010 . 1 . . . A 9 DC H2' . 19278 1 66 . 1 1 9 9 DC H2'' H 1 2.049 0.010 . 1 . . . A 9 DC H2'' . 19278 1 67 . 1 1 9 9 DC H3' H 1 4.413 0.010 . 1 . . . A 9 DC H3' . 19278 1 68 . 1 1 9 9 DC H4' H 1 2.122 0.010 . 1 . . . A 9 DC H4' . 19278 1 69 . 1 1 9 9 DC H5 H 1 5.211 0.010 . 1 . . . A 9 DC H5 . 19278 1 70 . 1 1 9 9 DC H5' H 1 3.353 0.010 . 2 . . . A 9 DC H5' . 19278 1 71 . 1 1 9 9 DC H5'' H 1 3.048 0.010 . 2 . . . A 9 DC H5'' . 19278 1 72 . 1 1 9 9 DC H6 H 1 7.193 0.010 . 1 . . . A 9 DC H6 . 19278 1 73 . 1 1 10 10 DA H1' H 1 6.314 0.010 . 1 . . . A 10 DA H1' . 19278 1 74 . 1 1 10 10 DA H2 H 1 8.037 0.010 . 1 . . . A 10 DA H2 . 19278 1 75 . 1 1 10 10 DA H2' H 1 2.994 0.010 . 1 . . . A 10 DA H2' . 19278 1 76 . 1 1 10 10 DA H2'' H 1 2.946 0.010 . 1 . . . A 10 DA H2'' . 19278 1 77 . 1 1 10 10 DA H3' H 1 4.817 0.010 . 1 . . . A 10 DA H3' . 19278 1 78 . 1 1 10 10 DA H4' H 1 4.333 0.010 . 1 . . . A 10 DA H4' . 19278 1 79 . 1 1 10 10 DA H5' H 1 3.977 0.010 . 2 . . . A 10 DA H5' . 19278 1 80 . 1 1 10 10 DA H5'' H 1 3.836 0.010 . 2 . . . A 10 DA H5'' . 19278 1 81 . 1 1 10 10 DA H8 H 1 8.076 0.010 . 1 . . . A 10 DA H8 . 19278 1 82 . 1 1 11 11 DT H1' H 1 5.680 0.010 . 1 . . . A 11 DT H1' . 19278 1 83 . 1 1 11 11 DT H2' H 1 2.092 0.010 . 1 . . . A 11 DT H2' . 19278 1 84 . 1 1 11 11 DT H2'' H 1 2.493 0.010 . 1 . . . A 11 DT H2'' . 19278 1 85 . 1 1 11 11 DT H3 H 1 13.295 0.010 . 1 . . . A 11 DT H3 . 19278 1 86 . 1 1 11 11 DT H3' H 1 4.741 0.010 . 1 . . . A 11 DT H3' . 19278 1 87 . 1 1 11 11 DT H4' H 1 4.284 0.010 . 1 . . . A 11 DT H4' . 19278 1 88 . 1 1 11 11 DT H5' H 1 4.330 0.010 . 2 . . . A 11 DT H5' . 19278 1 89 . 1 1 11 11 DT H5'' H 1 4.083 0.010 . 2 . . . A 11 DT H5'' . 19278 1 90 . 1 1 11 11 DT H6 H 1 7.389 0.010 . 1 . . . A 11 DT H6 . 19278 1 91 . 1 1 11 11 DT H71 H 1 1.830 0.010 . 2 . . . A 11 DT H71 . 19278 1 92 . 1 1 11 11 DT H72 H 1 1.830 0.010 . 2 . . . A 11 DT H72 . 19278 1 93 . 1 1 11 11 DT H73 H 1 1.830 0.010 . 2 . . . A 11 DT H73 . 19278 1 94 . 1 1 12 12 DT H1' H 1 6.026 0.010 . 1 . . . A 12 DT H1' . 19278 1 95 . 1 1 12 12 DT H2' H 1 2.159 0.010 . 1 . . . A 12 DT H2' . 19278 1 96 . 1 1 12 12 DT H2'' H 1 2.449 0.010 . 1 . . . A 12 DT H2'' . 19278 1 97 . 1 1 12 12 DT H3 H 1 13.872 0.010 . 1 . . . A 12 DT H3 . 19278 1 98 . 1 1 12 12 DT H3' H 1 4.842 0.010 . 1 . . . A 12 DT H3' . 19278 1 99 . 1 1 12 12 DT H4' H 1 4.206 0.010 . 1 . . . A 12 DT H4' . 19278 1 100 . 1 1 12 12 DT H6 H 1 7.399 0.010 . 1 . . . A 12 DT H6 . 19278 1 101 . 1 1 12 12 DT H71 H 1 1.612 0.010 . 2 . . . A 12 DT H71 . 19278 1 102 . 1 1 12 12 DT H72 H 1 1.612 0.010 . 2 . . . A 12 DT H72 . 19278 1 103 . 1 1 12 12 DT H73 H 1 1.612 0.010 . 2 . . . A 12 DT H73 . 19278 1 104 . 1 1 13 13 DC H1' H 1 5.558 0.010 . 1 . . . A 13 DC H1' . 19278 1 105 . 1 1 13 13 DC H2' H 1 2.003 0.010 . 1 . . . A 13 DC H2' . 19278 1 106 . 1 1 13 13 DC H2'' H 1 2.306 0.010 . 1 . . . A 13 DC H2'' . 19278 1 107 . 1 1 13 13 DC H3' H 1 4.778 0.010 . 1 . . . A 13 DC H3' . 19278 1 108 . 1 1 13 13 DC H4' H 1 4.100 0.010 . 1 . . . A 13 DC H4' . 19278 1 109 . 1 1 13 13 DC H5 H 1 5.626 0.010 . 1 . . . A 13 DC H5 . 19278 1 110 . 1 1 13 13 DC H6 H 1 7.439 0.010 . 1 . . . A 13 DC H6 . 19278 1 111 . 1 1 13 13 DC H41 H 1 8.483 0.010 . 1 . . . A 13 DC H41 . 19278 1 112 . 1 1 13 13 DC H42 H 1 6.850 0.010 . 1 . . . A 13 DC H42 . 19278 1 113 . 1 1 14 14 DG H1 H 1 12.817 0.010 . 1 . . . A 14 DG H1 . 19278 1 114 . 1 1 14 14 DG H1' H 1 5.711 0.010 . 1 . . . A 14 DG H1' . 19278 1 115 . 1 1 14 14 DG H2' H 1 2.447 0.010 . 1 . . . A 14 DG H2' . 19278 1 116 . 1 1 14 14 DG H2'' H 1 2.524 0.010 . 1 . . . A 14 DG H2'' . 19278 1 117 . 1 1 14 14 DG H3' H 1 4.839 0.010 . 1 . . . A 14 DG H3' . 19278 1 118 . 1 1 14 14 DG H4' H 1 4.247 0.010 . 1 . . . A 14 DG H4' . 19278 1 119 . 1 1 14 14 DG H8 H 1 7.744 0.010 . 1 . . . A 14 DG H8 . 19278 1 120 . 1 1 15 15 DC H1' H 1 5.604 0.010 . 1 . . . A 15 DC H1' . 19278 1 121 . 1 1 15 15 DC H2' H 1 1.545 0.010 . 1 . . . A 15 DC H2' . 19278 1 122 . 1 1 15 15 DC H2'' H 1 2.110 0.010 . 1 . . . A 15 DC H2'' . 19278 1 123 . 1 1 15 15 DC H3' H 1 4.650 0.010 . 1 . . . A 15 DC H3' . 19278 1 124 . 1 1 15 15 DC H4' H 1 4.009 0.010 . 1 . . . A 15 DC H4' . 19278 1 125 . 1 1 15 15 DC H5 H 1 5.169 0.010 . 1 . . . A 15 DC H5 . 19278 1 126 . 1 1 15 15 DC H6 H 1 6.989 0.010 . 1 . . . A 15 DC H6 . 19278 1 127 . 1 1 15 15 DC H41 H 1 8.165 0.010 . 1 . . . A 15 DC H41 . 19278 1 128 . 1 1 15 15 DC H42 H 1 6.308 0.010 . 1 . . . A 15 DC H42 . 19278 1 129 . 1 1 16 16 DG H1 H 1 13.121 0.010 . 1 . . . A 16 DG H1 . 19278 1 130 . 1 1 16 16 DG H1' H 1 5.541 0.010 . 1 . . . A 16 DG H1' . 19278 1 131 . 1 1 16 16 DG H2' H 1 2.485 0.010 . 1 . . . A 16 DG H2' . 19278 1 132 . 1 1 16 16 DG H2'' H 1 2.647 0.010 . 1 . . . A 16 DG H2'' . 19278 1 133 . 1 1 16 16 DG H3' H 1 4.950 0.010 . 1 . . . A 16 DG H3' . 19278 1 134 . 1 1 16 16 DG H4' H 1 4.276 0.010 . 1 . . . A 16 DG H4' . 19278 1 135 . 1 1 16 16 DG H8 H 1 7.595 0.010 . 1 . . . A 16 DG H8 . 19278 1 136 . 1 1 17 17 DG H1 H 1 11.182 0.010 . 1 . . . A 17 DG H1 . 19278 1 137 . 1 1 17 17 DG H1' H 1 5.998 0.010 . 1 . . . A 17 DG H1' . 19278 1 138 . 1 1 17 17 DG H2' H 1 2.649 0.010 . 1 . . . A 17 DG H2' . 19278 1 139 . 1 1 17 17 DG H2'' H 1 2.915 0.010 . 1 . . . A 17 DG H2'' . 19278 1 140 . 1 1 17 17 DG H3' H 1 5.024 0.010 . 1 . . . A 17 DG H3' . 19278 1 141 . 1 1 17 17 DG H4' H 1 4.461 0.010 . 1 . . . A 17 DG H4' . 19278 1 142 . 1 1 17 17 DG H8 H 1 7.918 0.010 . 1 . . . A 17 DG H8 . 19278 1 143 . 1 1 18 18 DG H1 H 1 11.191 0.010 . 1 . . . A 18 DG H1 . 19278 1 144 . 1 1 18 18 DG H1' H 1 6.205 0.010 . 1 . . . A 18 DG H1' . 19278 1 145 . 1 1 18 18 DG H2' H 1 2.720 0.010 . 1 . . . A 18 DG H2' . 19278 1 146 . 1 1 18 18 DG H2'' H 1 2.846 0.010 . 1 . . . A 18 DG H2'' . 19278 1 147 . 1 1 18 18 DG H3' H 1 5.026 0.010 . 1 . . . A 18 DG H3' . 19278 1 148 . 1 1 18 18 DG H4' H 1 4.671 0.010 . 1 . . . A 18 DG H4' . 19278 1 149 . 1 1 18 18 DG H8 H 1 7.730 0.010 . 1 . . . A 18 DG H8 . 19278 1 150 . 1 1 18 18 DG H21 H 1 9.789 0.010 . 1 . . . A 18 DG H21 . 19278 1 151 . 1 1 18 18 DG H22 H 1 8.714 0.010 . 1 . . . A 18 DG H22 . 19278 1 152 . 1 1 19 19 DG H1 H 1 11.350 0.010 . 1 . . . A 19 DG H1 . 19278 1 153 . 1 1 19 19 DG H1' H 1 6.051 0.010 . 1 . . . A 19 DG H1' . 19278 1 154 . 1 1 19 19 DG H2' H 1 2.229 0.010 . 1 . . . A 19 DG H2' . 19278 1 155 . 1 1 19 19 DG H2'' H 1 2.337 0.010 . 1 . . . A 19 DG H2'' . 19278 1 156 . 1 1 19 19 DG H3' H 1 4.685 0.010 . 1 . . . A 19 DG H3' . 19278 1 157 . 1 1 19 19 DG H4' H 1 2.820 0.010 . 1 . . . A 19 DG H4' . 19278 1 158 . 1 1 19 19 DG H5' H 1 3.725 0.010 . 2 . . . A 19 DG H5' . 19278 1 159 . 1 1 19 19 DG H5'' H 1 3.577 0.010 . 2 . . . A 19 DG H5'' . 19278 1 160 . 1 1 19 19 DG H8 H 1 7.498 0.010 . 1 . . . A 19 DG H8 . 19278 1 161 . 1 1 20 20 DA H1' H 1 6.661 0.010 . 1 . . . A 20 DA H1' . 19278 1 162 . 1 1 20 20 DA H2 H 1 8.481 0.010 . 1 . . . A 20 DA H2 . 19278 1 163 . 1 1 20 20 DA H2' H 1 3.197 0.010 . 1 . . . A 20 DA H2' . 19278 1 164 . 1 1 20 20 DA H2'' H 1 3.303 0.010 . 1 . . . A 20 DA H2'' . 19278 1 165 . 1 1 20 20 DA H3' H 1 5.476 0.010 . 1 . . . A 20 DA H3' . 19278 1 166 . 1 1 20 20 DA H4' H 1 4.440 0.010 . 1 . . . A 20 DA H4' . 19278 1 167 . 1 1 20 20 DA H5' H 1 4.248 0.010 . 2 . . . A 20 DA H5' . 19278 1 168 . 1 1 20 20 DA H5'' H 1 3.836 0.010 . 2 . . . A 20 DA H5'' . 19278 1 169 . 1 1 20 20 DA H8 H 1 8.782 0.010 . 1 . . . A 20 DA H8 . 19278 1 170 . 1 1 21 21 DG H1 H 1 11.229 0.010 . 1 . . . A 21 DG H1 . 19278 1 171 . 1 1 21 21 DG H1' H 1 6.258 0.010 . 1 . . . A 21 DG H1' . 19278 1 172 . 1 1 21 21 DG H2' H 1 2.624 0.010 . 1 . . . A 21 DG H2' . 19278 1 173 . 1 1 21 21 DG H2'' H 1 2.898 0.010 . 1 . . . A 21 DG H2'' . 19278 1 174 . 1 1 21 21 DG H3' H 1 4.968 0.010 . 1 . . . A 21 DG H3' . 19278 1 175 . 1 1 21 21 DG H4' H 1 4.471 0.010 . 1 . . . A 21 DG H4' . 19278 1 176 . 1 1 21 21 DG H5' H 1 4.473 0.010 . 2 . . . A 21 DG H5' . 19278 1 177 . 1 1 21 21 DG H5'' H 1 4.383 0.010 . 2 . . . A 21 DG H5'' . 19278 1 178 . 1 1 21 21 DG H8 H 1 7.920 0.010 . 1 . . . A 21 DG H8 . 19278 1 179 . 1 1 21 21 DG H21 H 1 9.226 0.010 . 1 . . . A 21 DG H21 . 19278 1 180 . 1 1 21 21 DG H22 H 1 6.786 0.010 . 1 . . . A 21 DG H22 . 19278 1 181 . 1 1 22 22 DG H1 H 1 11.129 0.010 . 1 . . . A 22 DG H1 . 19278 1 182 . 1 1 22 22 DG H1' H 1 6.509 0.010 . 1 . . . A 22 DG H1' . 19278 1 183 . 1 1 22 22 DG H2' H 1 2.730 0.010 . 1 . . . A 22 DG H2' . 19278 1 184 . 1 1 22 22 DG H2'' H 1 2.578 0.010 . 1 . . . A 22 DG H2'' . 19278 1 185 . 1 1 22 22 DG H3' H 1 5.110 0.010 . 1 . . . A 22 DG H3' . 19278 1 186 . 1 1 22 22 DG H4' H 1 4.691 0.010 . 1 . . . A 22 DG H4' . 19278 1 187 . 1 1 22 22 DG H8 H 1 8.085 0.010 . 1 . . . A 22 DG H8 . 19278 1 188 . 1 1 23 23 DT H1' H 1 6.548 0.010 . 1 . . . A 23 DT H1' . 19278 1 189 . 1 1 23 23 DT H2' H 1 2.472 0.010 . 1 . . . A 23 DT H2' . 19278 1 190 . 1 1 23 23 DT H2'' H 1 2.692 0.010 . 1 . . . A 23 DT H2'' . 19278 1 191 . 1 1 23 23 DT H3' H 1 5.116 0.010 . 1 . . . A 23 DT H3' . 19278 1 192 . 1 1 23 23 DT H4' H 1 4.689 0.010 . 1 . . . A 23 DT H4' . 19278 1 193 . 1 1 23 23 DT H5' H 1 4.366 0.010 . 2 . . . A 23 DT H5' . 19278 1 194 . 1 1 23 23 DT H5'' H 1 4.261 0.010 . 2 . . . A 23 DT H5'' . 19278 1 195 . 1 1 23 23 DT H6 H 1 7.881 0.010 . 1 . . . A 23 DT H6 . 19278 1 196 . 1 1 23 23 DT H71 H 1 1.994 0.010 . 2 . . . A 23 DT H71 . 19278 1 197 . 1 1 23 23 DT H72 H 1 1.994 0.010 . 2 . . . A 23 DT H72 . 19278 1 198 . 1 1 23 23 DT H73 H 1 1.994 0.010 . 2 . . . A 23 DT H73 . 19278 1 199 . 1 1 24 24 DG H1 H 1 11.758 0.010 . 1 . . . A 24 DG H1 . 19278 1 200 . 1 1 24 24 DG H1' H 1 6.184 0.010 . 1 . . . A 24 DG H1' . 19278 1 201 . 1 1 24 24 DG H2' H 1 2.544 0.010 . 1 . . . A 24 DG H2' . 19278 1 202 . 1 1 24 24 DG H2'' H 1 2.896 0.010 . 1 . . . A 24 DG H2'' . 19278 1 203 . 1 1 24 24 DG H3' H 1 5.157 0.010 . 1 . . . A 24 DG H3' . 19278 1 204 . 1 1 24 24 DG H4' H 1 4.489 0.010 . 1 . . . A 24 DG H4' . 19278 1 205 . 1 1 24 24 DG H8 H 1 8.001 0.010 . 1 . . . A 24 DG H8 . 19278 1 206 . 1 1 25 25 DG H1 H 1 11.421 0.010 . 1 . . . A 25 DG H1 . 19278 1 207 . 1 1 25 25 DG H1' H 1 6.147 0.010 . 1 . . . A 25 DG H1' . 19278 1 208 . 1 1 25 25 DG H2' H 1 2.692 0.010 . 1 . . . A 25 DG H2' . 19278 1 209 . 1 1 25 25 DG H2'' H 1 2.771 0.010 . 1 . . . A 25 DG H2'' . 19278 1 210 . 1 1 25 25 DG H3' H 1 4.986 0.010 . 1 . . . A 25 DG H3' . 19278 1 211 . 1 1 25 25 DG H4' H 1 4.541 0.010 . 1 . . . A 25 DG H4' . 19278 1 212 . 1 1 25 25 DG H8 H 1 7.991 0.010 . 1 . . . A 25 DG H8 . 19278 1 213 . 1 1 26 26 DG H1 H 1 11.124 0.010 . 1 . . . A 26 DG H1 . 19278 1 214 . 1 1 26 26 DG H1' H 1 6.219 0.010 . 1 . . . A 26 DG H1' . 19278 1 215 . 1 1 26 26 DG H2' H 1 2.457 0.010 . 1 . . . A 26 DG H2' . 19278 1 216 . 1 1 26 26 DG H2'' H 1 2.517 0.010 . 1 . . . A 26 DG H2'' . 19278 1 217 . 1 1 26 26 DG H3' H 1 4.818 0.010 . 1 . . . A 26 DG H3' . 19278 1 218 . 1 1 26 26 DG H4' H 1 3.969 0.010 . 1 . . . A 26 DG H4' . 19278 1 219 . 1 1 26 26 DG H5' H 1 3.804 0.010 . 2 . . . A 26 DG H5' . 19278 1 220 . 1 1 26 26 DG H5'' H 1 3.476 0.010 . 2 . . . A 26 DG H5'' . 19278 1 221 . 1 1 26 26 DG H8 H 1 7.754 0.010 . 1 . . . A 26 DG H8 . 19278 1 222 . 1 1 27 27 DG H1' H 1 6.287 0.010 . 1 . . . A 27 DG H1' . 19278 1 223 . 1 1 27 27 DG H2' H 1 2.969 0.010 . 1 . . . A 27 DG H2' . 19278 1 224 . 1 1 27 27 DG H2'' H 1 2.623 0.010 . 1 . . . A 27 DG H2'' . 19278 1 225 . 1 1 27 27 DG H3' H 1 4.999 0.010 . 1 . . . A 27 DG H3' . 19278 1 226 . 1 1 27 27 DG H4' H 1 4.267 0.010 . 1 . . . A 27 DG H4' . 19278 1 227 . 1 1 27 27 DG H8 H 1 7.959 0.010 . 1 . . . A 27 DG H8 . 19278 1 228 . 1 1 28 28 DA H1' H 1 6.232 0.010 . 1 . . . A 28 DA H1' . 19278 1 229 . 1 1 28 28 DA H2 H 1 8.120 0.010 . 1 . . . A 28 DA H2 . 19278 1 230 . 1 1 28 28 DA H2' H 1 2.612 0.010 . 1 . . . A 28 DA H2' . 19278 1 231 . 1 1 28 28 DA H2'' H 1 2.728 0.010 . 1 . . . A 28 DA H2'' . 19278 1 232 . 1 1 28 28 DA H3' H 1 4.938 0.010 . 1 . . . A 28 DA H3' . 19278 1 233 . 1 1 28 28 DA H4' H 1 4.366 0.010 . 1 . . . A 28 DA H4' . 19278 1 234 . 1 1 28 28 DA H5' H 1 4.072 0.010 . 2 . . . A 28 DA H5' . 19278 1 235 . 1 1 28 28 DA H5'' H 1 4.025 0.010 . 2 . . . A 28 DA H5'' . 19278 1 236 . 1 1 28 28 DA H8 H 1 8.322 0.010 . 1 . . . A 28 DA H8 . 19278 1 237 . 1 1 29 29 DA H1' H 1 6.454 0.010 . 1 . . . A 29 DA H1' . 19278 1 238 . 1 1 29 29 DA H2 H 1 8.205 0.010 . 1 . . . A 29 DA H2 . 19278 1 239 . 1 1 29 29 DA H2' H 1 2.860 0.010 . 1 . . . A 29 DA H2' . 19278 1 240 . 1 1 29 29 DA H2'' H 1 2.722 0.010 . 1 . . . A 29 DA H2'' . 19278 1 241 . 1 1 29 29 DA H3' H 1 5.092 0.010 . 1 . . . A 29 DA H3' . 19278 1 242 . 1 1 29 29 DA H4' H 1 4.226 0.010 . 1 . . . A 29 DA H4' . 19278 1 243 . 1 1 29 29 DA H8 H 1 8.279 0.010 . 1 . . . A 29 DA H8 . 19278 1 244 . 1 1 30 30 DG H1 H 1 11.538 0.010 . 1 . . . A 30 DG H1 . 19278 1 245 . 1 1 30 30 DG H1' H 1 6.164 0.010 . 1 . . . A 30 DG H1' . 19278 1 246 . 1 1 30 30 DG H2' H 1 2.753 0.010 . 1 . . . A 30 DG H2' . 19278 1 247 . 1 1 30 30 DG H2'' H 1 2.881 0.010 . 1 . . . A 30 DG H2'' . 19278 1 248 . 1 1 30 30 DG H3' H 1 4.944 0.010 . 1 . . . A 30 DG H3' . 19278 1 249 . 1 1 30 30 DG H4' H 1 4.474 0.010 . 1 . . . A 30 DG H4' . 19278 1 250 . 1 1 30 30 DG H5' H 1 4.221 0.010 . 2 . . . A 30 DG H5' . 19278 1 251 . 1 1 30 30 DG H5'' H 1 4.147 0.010 . 2 . . . A 30 DG H5'' . 19278 1 252 . 1 1 30 30 DG H8 H 1 8.109 0.010 . 1 . . . A 30 DG H8 . 19278 1 253 . 1 1 31 31 DG H1 H 1 11.538 0.010 . 1 . . . A 31 DG H1 . 19278 1 254 . 1 1 31 31 DG H1' H 1 6.229 0.010 . 1 . . . A 31 DG H1' . 19278 1 255 . 1 1 31 31 DG H2' H 1 2.740 0.010 . 1 . . . A 31 DG H2' . 19278 1 256 . 1 1 31 31 DG H2'' H 1 2.930 0.010 . 1 . . . A 31 DG H2'' . 19278 1 257 . 1 1 31 31 DG H3' H 1 5.078 0.010 . 1 . . . A 31 DG H3' . 19278 1 258 . 1 1 31 31 DG H4' H 1 4.609 0.010 . 1 . . . A 31 DG H4' . 19278 1 259 . 1 1 31 31 DG H8 H 1 7.927 0.010 . 1 . . . A 31 DG H8 . 19278 1 260 . 1 1 32 32 DG H1 H 1 11.443 0.010 . 1 . . . A 32 DG H1 . 19278 1 261 . 1 1 32 32 DG H1' H 1 6.361 0.010 . 1 . . . A 32 DG H1' . 19278 1 262 . 1 1 32 32 DG H2' H 1 2.608 0.010 . 1 . . . A 32 DG H2' . 19278 1 263 . 1 1 32 32 DG H2'' H 1 2.437 0.010 . 1 . . . A 32 DG H2'' . 19278 1 264 . 1 1 32 32 DG H3' H 1 4.718 0.010 . 1 . . . A 32 DG H3' . 19278 1 265 . 1 1 32 32 DG H4' H 1 4.386 0.010 . 1 . . . A 32 DG H4' . 19278 1 266 . 1 1 32 32 DG H8 H 1 7.853 0.010 . 1 . . . A 32 DG H8 . 19278 1 stop_ save_