data_34135 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 34135 _Entry.Title ; M2 G-quadruplex dilute solution ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2017-05-11 _Entry.Accession_date 2017-05-11 _Entry.Last_release_date 2018-04-03 _Entry.Original_release_date 2018-04-03 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.0.16 _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype SOLUTION _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_experimental_methods.ID _Entry_experimental_methods.Method _Entry_experimental_methods.Subtype _Entry_experimental_methods.Entry_ID 1 'SOLUTION NMR' 'SOLUTION NMR' 34135 stop_ loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 M. Trajkovski M. . . . 34135 2 J. Plavec J. . . . 34135 3 T. Endoh T. . . . 34135 4 H. Tateishi-Karimata H. . . . 34135 5 N. Sugimoto N. . . . 34135 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 34135 cosolute . 34135 interaction . 34135 quadruplex . 34135 solution-state . 34135 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 34135 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 182 34135 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2018-04-06 . original BMRB . 34135 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 34136 'M2 G-quadruplex 20 wt% ethylene glycol' 34135 BMRB 34137 'M2 G-quadruplex 10 wt% PEG8000' 34135 PDB 5NYS 'M2 G-quadruplex dilute solution' 34135 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 34135 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI 10.1093/nar/gky250 _Citation.PubMed_ID . _Citation.Full_citation . _Citation.Title ; M2 G-quadruplex ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM NARHAD _Citation.Journal_ISSN 1362-4962 _Citation.Journal_CSD 0389 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year 2018 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 M. Trajkovski M. . . . 34135 1 2 J. Plavec J. . . . 34135 1 3 T. Endoh T. . . . 34135 1 4 H. Tateishi-Karimata H. . . . 34135 1 5 N. Sugimoto N. . . . 34135 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 34135 _Assembly.ID 1 _Assembly.Name "DNA (5'-D(*TP*AP*GP*GP*GP*AP*CP*GP*GP*GP*CP*GP*GP*GP*CP*AP*GP*GP*GP*T)-3')" _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 A A yes . . . . . . 34135 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 34135 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; TAGGGACGGGCGGGCAGGGT ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 20 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 6321.064 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DT . 34135 1 2 . DA . 34135 1 3 . DG . 34135 1 4 . DG . 34135 1 5 . DG . 34135 1 6 . DA . 34135 1 7 . DC . 34135 1 8 . DG . 34135 1 9 . DG . 34135 1 10 . DG . 34135 1 11 . DC . 34135 1 12 . DG . 34135 1 13 . DG . 34135 1 14 . DG . 34135 1 15 . DC . 34135 1 16 . DA . 34135 1 17 . DG . 34135 1 18 . DG . 34135 1 19 . DG . 34135 1 20 . DT . 34135 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DT 1 1 34135 1 . DA 2 2 34135 1 . DG 3 3 34135 1 . DG 4 4 34135 1 . DG 5 5 34135 1 . DA 6 6 34135 1 . DC 7 7 34135 1 . DG 8 8 34135 1 . DG 9 9 34135 1 . DG 10 10 34135 1 . DC 11 11 34135 1 . DG 12 12 34135 1 . DG 13 13 34135 1 . DG 14 14 34135 1 . DC 15 15 34135 1 . DA 16 16 34135 1 . DG 17 17 34135 1 . DG 18 18 34135 1 . DG 19 19 34135 1 . DT 20 20 34135 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 34135 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 32630 'no natural source' . 'synthetic construct' . . . . . . . . . . . . . . . . . . . . 34135 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 34135 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 34135 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 34135 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.2 mM 0 M2, 1 mM 0 M2, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 M2 'natural abundance' . . 1 $entity_1 . . 0.2 . . mM . . . . 34135 1 2 'potassium chloride' 'natural abundance' . . . . . . 100 . . mM . . . . 34135 1 3 'potassium phosphate' 'natural abundance' . . . . . . 20 . . mM . . . . 34135 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 34135 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 120 . mM 34135 1 pH 7.0 . pH 34135 1 pressure 1 . bar 34135 1 temperature 298 . K 34135 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 34135 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 120 . mM 34135 2 pH 7.0 . pH 34135 2 pressure 1 . bar 34135 2 temperature 298 . K 34135 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 34135 _Software.ID 1 _Software.Type . _Software.Name AMBER _Software.Version 14 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 34135 1 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure calculation' 34135 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 34135 _Software.ID 2 _Software.Type . _Software.Name VNMRJ _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Varian . . 34135 2 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID collection 34135 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 34135 _Software.ID 3 _Software.Type . _Software.Name SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 34135 3 stop_ loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' 34135 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 34135 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Agilent-Varian _NMR_spectrometer.Model "Agilent-Varian 'Uniform NMR System' 1" _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 34135 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Agilent-Varian _NMR_spectrometer.Model "Agilent-Varian 'Uniform NMR System' 2" _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 34135 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Agilent-Varian 'Agilent-Varian Uniform NMR System 1' . 600 . . . 34135 1 2 NMR_spectrometer_2 Agilent-Varian 'Agilent-Varian Uniform NMR System 2' . 800 . . . 34135 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 34135 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 34135 1 2 '2D DQF-COSY' no . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 34135 1 3 '2D 1H-13C HSQC' no . . . . . . . . . . 1 $sample_1 anisotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . 34135 1 4 '2D 1H-1H TOCSY' no . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 34135 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 34135 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0 external direct 1.0 . . . . . 34135 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 34135 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 34135 1 2 '2D DQF-COSY' . . . 34135 1 3 '2D 1H-13C HSQC' . . . 34135 1 4 '2D 1H-1H TOCSY' . . . 34135 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 DT H1' H 1 5.839 0.002 . 1 . . . . A 1 DT H1' . 34135 1 2 . 1 1 1 1 DT H2' H 1 1.704 0.003 . 1 . . . . A 1 DT H2' . 34135 1 3 . 1 1 1 1 DT H2'' H 1 2.155 0.003 . 1 . . . . A 1 DT H2'' . 34135 1 4 . 1 1 1 1 DT H3' H 1 4.506 0.001 . 1 . . . . A 1 DT H3' . 34135 1 5 . 1 1 1 1 DT H4' H 1 3.940 0.001 . 1 . . . . A 1 DT H4' . 34135 1 6 . 1 1 1 1 DT H5' H 1 3.504 0.001 . 2 . . . . A 1 DT H5' . 34135 1 7 . 1 1 1 1 DT H5'' H 1 3.504 0.001 . 2 . . . . A 1 DT H5'' . 34135 1 8 . 1 1 1 1 DT H6 H 1 7.180 0.000 . 1 . . . . A 1 DT H6 . 34135 1 9 . 1 1 1 1 DT H71 H 1 1.607 0.004 . 2 . . . . A 1 DT H71 . 34135 1 10 . 1 1 1 1 DT H72 H 1 1.607 0.004 . 2 . . . . A 1 DT H72 . 34135 1 11 . 1 1 1 1 DT H73 H 1 1.607 0.004 . 2 . . . . A 1 DT H73 . 34135 1 12 . 1 1 2 2 DA H1' H 1 5.857 0.006 . 1 . . . . A 2 DA H1' . 34135 1 13 . 1 1 2 2 DA H2 H 1 7.885 0.001 . 1 . . . . A 2 DA H2 . 34135 1 14 . 1 1 2 2 DA H2' H 1 2.487 0.002 . 1 . . . . A 2 DA H2' . 34135 1 15 . 1 1 2 2 DA H2'' H 1 2.672 0.001 . 1 . . . . A 2 DA H2'' . 34135 1 16 . 1 1 2 2 DA H3' H 1 4.900 0.010 . 1 . . . . A 2 DA H3' . 34135 1 17 . 1 1 2 2 DA H4' H 1 4.180 0.001 . 1 . . . . A 2 DA H4' . 34135 1 18 . 1 1 2 2 DA H5' H 1 3.744 0.002 . 1 . . . . A 2 DA H5' . 34135 1 19 . 1 1 2 2 DA H5'' H 1 3.930 0.004 . 1 . . . . A 2 DA H5'' . 34135 1 20 . 1 1 2 2 DA H8 H 1 8.040 0.001 . 1 . . . . A 2 DA H8 . 34135 1 21 . 1 1 3 3 DG H1 H 1 11.689 0.002 . 1 . . . . A 3 DG H1 . 34135 1 22 . 1 1 3 3 DG H1' H 1 6.133 0.002 . 1 . . . . A 3 DG H1' . 34135 1 23 . 1 1 3 3 DG H2' H 1 2.848 0.002 . 1 . . . . A 3 DG H2' . 34135 1 24 . 1 1 3 3 DG H2'' H 1 3.056 0.000 . 1 . . . . A 3 DG H2'' . 34135 1 25 . 1 1 3 3 DG H3' H 1 5.054 0.005 . 1 . . . . A 3 DG H3' . 34135 1 26 . 1 1 3 3 DG H4' H 1 4.534 0.001 . 1 . . . . A 3 DG H4' . 34135 1 27 . 1 1 3 3 DG H5' H 1 4.165 0.003 . 1 . . . . A 3 DG H5' . 34135 1 28 . 1 1 3 3 DG H5'' H 1 4.222 0.002 . 1 . . . . A 3 DG H5'' . 34135 1 29 . 1 1 3 3 DG H8 H 1 8.110 0.001 . 1 . . . . A 3 DG H8 . 34135 1 30 . 1 1 4 4 DG H1 H 1 11.563 0.002 . 1 . . . . A 4 DG H1 . 34135 1 31 . 1 1 4 4 DG H1' H 1 6.127 0.001 . 1 . . . . A 4 DG H1' . 34135 1 32 . 1 1 4 4 DG H2' H 1 2.682 0.003 . 1 . . . . A 4 DG H2' . 34135 1 33 . 1 1 4 4 DG H2'' H 1 2.790 0.002 . 1 . . . . A 4 DG H2'' . 34135 1 34 . 1 1 4 4 DG H3' H 1 4.988 0.003 . 1 . . . . A 4 DG H3' . 34135 1 35 . 1 1 4 4 DG H4' H 1 4.531 0.001 . 1 . . . . A 4 DG H4' . 34135 1 36 . 1 1 4 4 DG H5' H 1 4.346 0.003 . 2 . . . . A 4 DG H5' . 34135 1 37 . 1 1 4 4 DG H5'' H 1 4.346 0.003 . 2 . . . . A 4 DG H5'' . 34135 1 38 . 1 1 4 4 DG H8 H 1 7.781 0.002 . 1 . . . . A 4 DG H8 . 34135 1 39 . 1 1 5 5 DG H1 H 1 11.352 0.002 . 1 . . . . A 5 DG H1 . 34135 1 40 . 1 1 5 5 DG H1' H 1 6.291 0.001 . 1 . . . . A 5 DG H1' . 34135 1 41 . 1 1 5 5 DG H2' H 1 2.521 0.003 . 1 . . . . A 5 DG H2' . 34135 1 42 . 1 1 5 5 DG H2'' H 1 2.478 0.004 . 1 . . . . A 5 DG H2'' . 34135 1 43 . 1 1 5 5 DG H3' H 1 4.966 0.002 . 1 . . . . A 5 DG H3' . 34135 1 44 . 1 1 5 5 DG H4' H 1 4.171 0.002 . 1 . . . . A 5 DG H4' . 34135 1 45 . 1 1 5 5 DG H5' H 1 4.010 0.006 . 1 . . . . A 5 DG H5' . 34135 1 46 . 1 1 5 5 DG H5'' H 1 3.614 0.005 . 1 . . . . A 5 DG H5'' . 34135 1 47 . 1 1 5 5 DG H8 H 1 7.705 0.001 . 1 . . . . A 5 DG H8 . 34135 1 48 . 1 1 6 6 DA H1' H 1 6.572 0.002 . 1 . . . . A 6 DA H1' . 34135 1 49 . 1 1 6 6 DA H2 H 1 8.400 0.002 . 1 . . . . A 6 DA H2 . 34135 1 50 . 1 1 6 6 DA H2' H 1 3.061 0.006 . 1 . . . . A 6 DA H2' . 34135 1 51 . 1 1 6 6 DA H2'' H 1 2.948 0.001 . 1 . . . . A 6 DA H2'' . 34135 1 52 . 1 1 6 6 DA H3' H 1 5.066 0.004 . 1 . . . . A 6 DA H3' . 34135 1 53 . 1 1 6 6 DA H4' H 1 4.533 0.004 . 1 . . . . A 6 DA H4' . 34135 1 54 . 1 1 6 6 DA H5'' H 1 4.167 0.003 . 1 . . . . A 6 DA H5'' . 34135 1 55 . 1 1 6 6 DA H8 H 1 8.626 0.001 . 1 . . . . A 6 DA H8 . 34135 1 56 . 1 1 7 7 DC H1' H 1 6.402 0.000 . 1 . . . . A 7 DC H1' . 34135 1 57 . 1 1 7 7 DC H2' H 1 2.450 0.000 . 1 . . . . A 7 DC H2' . 34135 1 58 . 1 1 7 7 DC H2'' H 1 2.708 0.001 . 1 . . . . A 7 DC H2'' . 34135 1 59 . 1 1 7 7 DC H3' H 1 4.970 0.003 . 1 . . . . A 7 DC H3' . 34135 1 60 . 1 1 7 7 DC H4' H 1 4.492 0.002 . 1 . . . . A 7 DC H4' . 34135 1 61 . 1 1 7 7 DC H5 H 1 6.104 0.000 . 1 . . . . A 7 DC H5 . 34135 1 62 . 1 1 7 7 DC H5' H 1 4.305 0.001 . 1 . . . . A 7 DC H5' . 34135 1 63 . 1 1 7 7 DC H6 H 1 7.958 0.003 . 1 . . . . A 7 DC H6 . 34135 1 64 . 1 1 8 8 DG H1 H 1 11.925 0.001 . 1 . . . . A 8 DG H1 . 34135 1 65 . 1 1 8 8 DG H1' H 1 6.165 0.001 . 1 . . . . A 8 DG H1' . 34135 1 66 . 1 1 8 8 DG H2' H 1 2.484 0.002 . 1 . . . . A 8 DG H2' . 34135 1 67 . 1 1 8 8 DG H2'' H 1 3.052 0.002 . 1 . . . . A 8 DG H2'' . 34135 1 68 . 1 1 8 8 DG H3' H 1 4.861 0.002 . 1 . . . . A 8 DG H3' . 34135 1 69 . 1 1 8 8 DG H4' H 1 4.430 0.004 . 1 . . . . A 8 DG H4' . 34135 1 70 . 1 1 8 8 DG H5' H 1 3.616 0.002 . 1 . . . . A 8 DG H5' . 34135 1 71 . 1 1 8 8 DG H5'' H 1 4.047 0.003 . 1 . . . . A 8 DG H5'' . 34135 1 72 . 1 1 8 8 DG H8 H 1 7.955 0.001 . 1 . . . . A 8 DG H8 . 34135 1 73 . 1 1 9 9 DG H1 H 1 11.448 0.006 . 1 . . . . A 9 DG H1 . 34135 1 74 . 1 1 9 9 DG H1' H 1 6.277 0.001 . 1 . . . . A 9 DG H1' . 34135 1 75 . 1 1 9 9 DG H2' H 1 2.810 0.001 . 1 . . . . A 9 DG H2' . 34135 1 76 . 1 1 9 9 DG H2'' H 1 3.004 0.001 . 1 . . . . A 9 DG H2'' . 34135 1 77 . 1 1 9 9 DG H3' H 1 5.112 0.001 . 1 . . . . A 9 DG H3' . 34135 1 78 . 1 1 9 9 DG H4' H 1 4.613 0.005 . 1 . . . . A 9 DG H4' . 34135 1 79 . 1 1 9 9 DG H5' H 1 4.330 0.005 . 2 . . . . A 9 DG H5' . 34135 1 80 . 1 1 9 9 DG H5'' H 1 4.330 0.005 . 2 . . . . A 9 DG H5'' . 34135 1 81 . 1 1 9 9 DG H8 H 1 8.020 0.000 . 1 . . . . A 9 DG H8 . 34135 1 82 . 1 1 10 10 DG H1 H 1 11.264 0.003 . 1 . . . . A 10 DG H1 . 34135 1 83 . 1 1 10 10 DG H1' H 1 6.464 0.002 . 1 . . . . A 10 DG H1' . 34135 1 84 . 1 1 10 10 DG H2' H 1 2.732 0.001 . 1 . . . . A 10 DG H2' . 34135 1 85 . 1 1 10 10 DG H2'' H 1 2.571 0.002 . 1 . . . . A 10 DG H2'' . 34135 1 86 . 1 1 10 10 DG H3' H 1 5.132 0.002 . 1 . . . . A 10 DG H3' . 34135 1 87 . 1 1 10 10 DG H4' H 1 4.656 0.002 . 1 . . . . A 10 DG H4' . 34135 1 88 . 1 1 10 10 DG H5' H 1 4.331 0.002 . 1 . . . . A 10 DG H5' . 34135 1 89 . 1 1 10 10 DG H5'' H 1 4.422 0.005 . 1 . . . . A 10 DG H5'' . 34135 1 90 . 1 1 10 10 DG H8 H 1 7.864 0.001 . 1 . . . . A 10 DG H8 . 34135 1 91 . 1 1 11 11 DC H1' H 1 6.509 0.003 . 1 . . . . A 11 DC H1' . 34135 1 92 . 1 1 11 11 DC H2' H 1 2.447 0.003 . 1 . . . . A 11 DC H2' . 34135 1 93 . 1 1 11 11 DC H2'' H 1 2.767 0.001 . 1 . . . . A 11 DC H2'' . 34135 1 94 . 1 1 11 11 DC H3' H 1 5.115 0.002 . 1 . . . . A 11 DC H3' . 34135 1 95 . 1 1 11 11 DC H4' H 1 4.641 0.001 . 1 . . . . A 11 DC H4' . 34135 1 96 . 1 1 11 11 DC H5 H 1 6.192 0.000 . 1 . . . . A 11 DC H5 . 34135 1 97 . 1 1 11 11 DC H5' H 1 4.393 0.002 . 2 . . . . A 11 DC H5' . 34135 1 98 . 1 1 11 11 DC H5'' H 1 4.393 0.002 . 2 . . . . A 11 DC H5'' . 34135 1 99 . 1 1 11 11 DC H6 H 1 8.025 0.003 . 1 . . . . A 11 DC H6 . 34135 1 100 . 1 1 12 12 DG H1 H 1 11.950 0.001 . 1 . . . . A 12 DG H1 . 34135 1 101 . 1 1 12 12 DG H1' H 1 6.228 0.004 . 1 . . . . A 12 DG H1' . 34135 1 102 . 1 1 12 12 DG H2' H 1 2.567 0.001 . 1 . . . . A 12 DG H2' . 34135 1 103 . 1 1 12 12 DG H2'' H 1 2.997 0.001 . 1 . . . . A 12 DG H2'' . 34135 1 104 . 1 1 12 12 DG H3' H 1 5.202 0.002 . 1 . . . . A 12 DG H3' . 34135 1 105 . 1 1 12 12 DG H4' H 1 4.515 0.001 . 1 . . . . A 12 DG H4' . 34135 1 106 . 1 1 12 12 DG H5' H 1 4.382 0.002 . 1 . . . . A 12 DG H5' . 34135 1 107 . 1 1 12 12 DG H5'' H 1 4.271 0.003 . 1 . . . . A 12 DG H5'' . 34135 1 108 . 1 1 12 12 DG H8 H 1 8.109 0.000 . 1 . . . . A 12 DG H8 . 34135 1 109 . 1 1 13 13 DG H1 H 1 11.493 0.002 . 1 . . . . A 13 DG H1 . 34135 1 110 . 1 1 13 13 DG H1' H 1 6.191 0.002 . 1 . . . . A 13 DG H1' . 34135 1 111 . 1 1 13 13 DG H2' H 1 2.720 0.001 . 1 . . . . A 13 DG H2' . 34135 1 112 . 1 1 13 13 DG H2'' H 1 2.885 0.002 . 1 . . . . A 13 DG H2'' . 34135 1 113 . 1 1 13 13 DG H3' H 1 5.106 0.004 . 1 . . . . A 13 DG H3' . 34135 1 114 . 1 1 13 13 DG H4' H 1 4.476 0.003 . 1 . . . . A 13 DG H4' . 34135 1 115 . 1 1 13 13 DG H5' H 1 4.260 0.001 . 1 . . . . A 13 DG H5' . 34135 1 116 . 1 1 13 13 DG H5'' H 1 4.312 0.007 . 1 . . . . A 13 DG H5'' . 34135 1 117 . 1 1 13 13 DG H8 H 1 7.989 0.001 . 1 . . . . A 13 DG H8 . 34135 1 118 . 1 1 14 14 DG H1 H 1 11.078 0.004 . 1 . . . . A 14 DG H1 . 34135 1 119 . 1 1 14 14 DG H1' H 1 6.418 0.001 . 1 . . . . A 14 DG H1' . 34135 1 120 . 1 1 14 14 DG H2' H 1 2.664 0.004 . 1 . . . . A 14 DG H2' . 34135 1 121 . 1 1 14 14 DG H2'' H 1 2.520 0.001 . 1 . . . . A 14 DG H2'' . 34135 1 122 . 1 1 14 14 DG H3' H 1 5.009 0.005 . 1 . . . . A 14 DG H3' . 34135 1 123 . 1 1 14 14 DG H4' H 1 4.507 0.008 . 1 . . . . A 14 DG H4' . 34135 1 124 . 1 1 14 14 DG H5' H 1 4.295 0.004 . 2 . . . . A 14 DG H5' . 34135 1 125 . 1 1 14 14 DG H5'' H 1 4.295 0.004 . 2 . . . . A 14 DG H5'' . 34135 1 126 . 1 1 14 14 DG H8 H 1 7.833 0.001 . 1 . . . . A 14 DG H8 . 34135 1 127 . 1 1 15 15 DC H1' H 1 6.226 0.000 . 1 . . . . A 15 DC H1' . 34135 1 128 . 1 1 15 15 DC H2' H 1 2.158 0.001 . 1 . . . . A 15 DC H2' . 34135 1 129 . 1 1 15 15 DC H2'' H 1 2.520 0.008 . 1 . . . . A 15 DC H2'' . 34135 1 130 . 1 1 15 15 DC H3' H 1 4.720 0.002 . 1 . . . . A 15 DC H3' . 34135 1 131 . 1 1 15 15 DC H4' H 1 3.901 0.002 . 1 . . . . A 15 DC H4' . 34135 1 132 . 1 1 15 15 DC H5 H 1 6.129 0.000 . 1 . . . . A 15 DC H5 . 34135 1 133 . 1 1 15 15 DC H5' H 1 3.728 0.002 . 2 . . . . A 15 DC H5' . 34135 1 134 . 1 1 15 15 DC H5'' H 1 3.728 0.002 . 2 . . . . A 15 DC H5'' . 34135 1 135 . 1 1 15 15 DC H6 H 1 7.807 0.003 . 1 . . . . A 15 DC H6 . 34135 1 136 . 1 1 16 16 DA H1' H 1 6.699 0.002 . 1 . . . . A 16 DA H1' . 34135 1 137 . 1 1 16 16 DA H2 H 1 8.384 0.001 . 1 . . . . A 16 DA H2 . 34135 1 138 . 1 1 16 16 DA H2' H 1 3.128 0.001 . 1 . . . . A 16 DA H2' . 34135 1 139 . 1 1 16 16 DA H2'' H 1 2.986 0.002 . 1 . . . . A 16 DA H2'' . 34135 1 140 . 1 1 16 16 DA H3' H 1 5.204 0.002 . 1 . . . . A 16 DA H3' . 34135 1 141 . 1 1 16 16 DA H4' H 1 4.606 0.004 . 1 . . . . A 16 DA H4' . 34135 1 142 . 1 1 16 16 DA H5' H 1 4.226 0.002 . 1 . . . . A 16 DA H5' . 34135 1 143 . 1 1 16 16 DA H5'' H 1 4.313 0.004 . 1 . . . . A 16 DA H5'' . 34135 1 144 . 1 1 16 16 DA H8 H 1 8.530 0.001 . 1 . . . . A 16 DA H8 . 34135 1 145 . 1 1 17 17 DG H1 H 1 11.417 0.008 . 1 . . . . A 17 DG H1 . 34135 1 146 . 1 1 17 17 DG H1' H 1 6.108 0.001 . 1 . . . . A 17 DG H1' . 34135 1 147 . 1 1 17 17 DG H2' H 1 2.589 0.001 . 1 . . . . A 17 DG H2' . 34135 1 148 . 1 1 17 17 DG H2'' H 1 2.850 0.002 . 1 . . . . A 17 DG H2'' . 34135 1 149 . 1 1 17 17 DG H3' H 1 5.030 0.004 . 1 . . . . A 17 DG H3' . 34135 1 150 . 1 1 17 17 DG H4' H 1 4.499 0.005 . 1 . . . . A 17 DG H4' . 34135 1 151 . 1 1 17 17 DG H5' H 1 4.301 0.000 . 1 . . . . A 17 DG H5' . 34135 1 152 . 1 1 17 17 DG H5'' H 1 4.213 0.003 . 1 . . . . A 17 DG H5'' . 34135 1 153 . 1 1 17 17 DG H8 H 1 8.103 0.001 . 1 . . . . A 17 DG H8 . 34135 1 154 . 1 1 18 18 DG H1 H 1 11.346 0.006 . 1 . . . . A 18 DG H1 . 34135 1 155 . 1 1 18 18 DG H1' H 1 6.094 0.002 . 1 . . . . A 18 DG H1' . 34135 1 156 . 1 1 18 18 DG H2' H 1 2.749 0.002 . 1 . . . . A 18 DG H2' . 34135 1 157 . 1 1 18 18 DG H2'' H 1 2.779 0.001 . 1 . . . . A 18 DG H2'' . 34135 1 158 . 1 1 18 18 DG H3' H 1 5.054 0.002 . 1 . . . . A 18 DG H3' . 34135 1 159 . 1 1 18 18 DG H4' H 1 4.532 0.003 . 1 . . . . A 18 DG H4' . 34135 1 160 . 1 1 18 18 DG H5' H 1 4.229 0.005 . 2 . . . . A 18 DG H5' . 34135 1 161 . 1 1 18 18 DG H5'' H 1 4.229 0.005 . 2 . . . . A 18 DG H5'' . 34135 1 162 . 1 1 18 18 DG H8 H 1 7.884 0.002 . 1 . . . . A 18 DG H8 . 34135 1 163 . 1 1 19 19 DG H1 H 1 11.180 0.007 . 1 . . . . A 19 DG H1 . 34135 1 164 . 1 1 19 19 DG H1' H 1 6.227 0.003 . 1 . . . . A 19 DG H1' . 34135 1 165 . 1 1 19 19 DG H2' H 1 2.621 0.001 . 1 . . . . A 19 DG H2' . 34135 1 166 . 1 1 19 19 DG H2'' H 1 2.795 0.003 . 1 . . . . A 19 DG H2'' . 34135 1 167 . 1 1 19 19 DG H3' H 1 4.942 0.006 . 1 . . . . A 19 DG H3' . 34135 1 168 . 1 1 19 19 DG H4' H 1 4.537 0.002 . 1 . . . . A 19 DG H4' . 34135 1 169 . 1 1 19 19 DG H5' H 1 4.313 0.001 . 1 . . . . A 19 DG H5' . 34135 1 170 . 1 1 19 19 DG H5'' H 1 4.266 0.001 . 1 . . . . A 19 DG H5'' . 34135 1 171 . 1 1 19 19 DG H8 H 1 7.736 0.000 . 1 . . . . A 19 DG H8 . 34135 1 172 . 1 1 20 20 DT H1' H 1 5.929 0.002 . 1 . . . . A 20 DT H1' . 34135 1 173 . 1 1 20 20 DT H2' H 1 2.094 0.004 . 2 . . . . A 20 DT H2' . 34135 1 174 . 1 1 20 20 DT H2'' H 1 2.094 0.004 . 2 . . . . A 20 DT H2'' . 34135 1 175 . 1 1 20 20 DT H3' H 1 4.451 0.002 . 1 . . . . A 20 DT H3' . 34135 1 176 . 1 1 20 20 DT H4' H 1 3.987 0.003 . 1 . . . . A 20 DT H4' . 34135 1 177 . 1 1 20 20 DT H5' H 1 4.257 0.005 . 1 . . . . A 20 DT H5' . 34135 1 178 . 1 1 20 20 DT H5'' H 1 4.090 0.002 . 1 . . . . A 20 DT H5'' . 34135 1 179 . 1 1 20 20 DT H6 H 1 7.157 0.002 . 1 . . . . A 20 DT H6 . 34135 1 180 . 1 1 20 20 DT H71 H 1 1.531 0.001 . 2 . . . . A 20 DT H71 . 34135 1 181 . 1 1 20 20 DT H72 H 1 1.531 0.001 . 2 . . . . A 20 DT H72 . 34135 1 182 . 1 1 20 20 DT H73 H 1 1.531 0.001 . 2 . . . . A 20 DT H73 . 34135 1 stop_ save_