data_4250 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 4250 _Entry.Title ; Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 1998-10-15 _Entry.Accession_date 1998-10-15 _Entry.Last_release_date 2000-02-25 _Entry.Original_release_date 2000-02-25 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 2.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 M. Kolk . H. . 4250 2 M. 'van der Graaf' . . . 4250 3 C. Fransen . T.M. . 4250 4 S. Wijmenga . S. . 4250 5 C. Pleij . W.A. . 4250 6 H. Heus . A. . 4250 7 C. Hilbers . W. . 4250 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 4250 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 149 4250 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2000-02-25 1998-10-15 original author . 4250 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 3PHP 'BMRB Entry Tracking System' 4250 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 4250 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code 9857204 _Citation.DOI . _Citation.PubMed_ID . _Citation.Full_citation . _Citation.Title "Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding" _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'EMBO J.' _Citation.Journal_name_full . _Citation.Journal_volume 17 _Citation.Journal_issue 24 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 7498 _Citation.Page_last 7504 _Citation.Year 1998 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 M. Kolk . H. . 4250 1 2 M. 'van der Graaf' . . . 4250 1 3 C. Fransen . T.M. . 4250 1 4 S. Wijmenga . S. . 4250 1 5 C. Pleij . W.A. . 4250 1 6 H. Heus . A. . 4250 1 7 C. Hilbers . W. . 4250 1 stop_ loop_ _Citation_keyword.Keyword _Citation_keyword.Entry_ID _Citation_keyword.Citation_ID pseudoknot 4250 1 'Ribonucleic acid' 4250 1 RNA 4250 1 TYMV 4250 1 stop_ save_ save_citation_one _Citation.Sf_category citations _Citation.Sf_framecode citation_one _Citation.Entry_ID 4250 _Citation.ID 2 _Citation.Class 'reference citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 8589602 _Citation.Full_citation ; Wishart, D. S., Bigam, C. G., Yao, J., Abildgaard, F., Dyson, H. J., Oldfield, E., Markley, J. L., and Sykes, B. D. J. Biomol. NMR 6, 135-140 (1995). ; _Citation.Title '1H, 13C and 15N chemical shift referencing in biomolecular NMR.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Biomol. NMR' _Citation.Journal_name_full 'Journal of biomolecular NMR' _Citation.Journal_volume 6 _Citation.Journal_issue 2 _Citation.Journal_ASTM . _Citation.Journal_ISSN 0925-2738 _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 135 _Citation.Page_last 140 _Citation.Year 1995 _Citation.Details ; A considerable degree of variability exists in the way that 1H, 13C and 15N chemical shifts are reported and referenced for biomolecules. In this article we explore some of the reasons for this situation and propose guidelines for future chemical shift referencing and for conversion from many common 1H, 13C and 15N chemical shift standards, now used in biomolecular NMR, to those proposed here. ; loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 'D S' Wishart D. S. . 4250 2 2 'C G' Bigam C. G. . 4250 2 3 J Yao J. . . 4250 2 4 F Abildgaard F. . . 4250 2 5 'H J' Dyson H. J. . 4250 2 6 E Oldfield E. . . 4250 2 7 'J L' Markley J. L. . 4250 2 8 'B D' Sykes B. D. . 4250 2 stop_ save_ save_citation_two _Citation.Sf_category citations _Citation.Sf_framecode citation_two _Citation.Entry_ID 4250 _Citation.ID 3 _Citation.Class 'reference citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 8520220 _Citation.Full_citation 'Delaglio, F. et al. J.Biomol.NMR 6, 277-293 (1994).' _Citation.Title 'NMRPipe: a multidimensional spectral processing system based on UNIX pipes.' _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Biomol. NMR' _Citation.Journal_name_full 'Journal of biomolecular NMR' _Citation.Journal_volume 6 _Citation.Journal_issue 3 _Citation.Journal_ASTM . _Citation.Journal_ISSN 0925-2738 _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 277 _Citation.Page_last 293 _Citation.Year 1995 _Citation.Details ; The NMRPipe system is a UNIX software environment of processing, graphics, and analysis tools designed to meet current routine and research-oriented multidimensional processing requirements, and to anticipate and accommodate future demands and developments. The system is based on UNIX pipes, which allow programs running simultaneously to exchange streams of data under user control. In an NMRPipe processing scheme, a stream of spectral data flows through a pipeline of processing programs, each of which performs one component of the overall scheme, such as Fourier transformation or linear prediction. Complete multidimensional processing schemes are constructed as simple UNIX shell scripts. The processing modules themselves maintain and exploit accurate records of data sizes, detection modes, and calibration information in all dimensions, so that schemes can be constructed without the need to explicitly define or anticipate data sizes or storage details of real and imaginary channels during processing. The asynchronous pipeline scheme provides other substantial advantages, including high flexibility, favorable processing speeds, choice of both all-in-memory and disk-bound processing, easy adaptation to different data formats, simpler software development and maintenance, and the ability to distribute processing tasks on multi-CPU computers and computer networks. ; loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 F Delaglio F. . . 4250 3 2 S Grzesiek S. . . 4250 3 3 'G W' Vuister G. W. . 4250 3 4 G Zhu G. . . 4250 3 5 J Pfeifer J. . . 4250 3 6 A Bax A. . . 4250 3 stop_ save_ save_citation_three _Citation.Sf_category citations _Citation.Sf_framecode citation_three _Citation.Entry_ID 4250 _Citation.ID 4 _Citation.Class 'reference citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID . _Citation.Full_citation 'Garrett, D.S. J.Magn.Reson. 95, 214-220 (1991).' _Citation.Title . _Citation.Status . _Citation.Type . _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . save_ ############################################# # Molecular system (assembly) description # ############################################# save_system_TYMV-RNA _Assembly.Sf_category assembly _Assembly.Sf_framecode system_TYMV-RNA _Assembly.Entry_ID 4250 _Assembly.ID 1 _Assembly.Name "3' hairpin of TYMV pseudoknot" _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Assembly_type.Type _Assembly_type.Entry_ID _Assembly_type.Assembly_ID monomer 4250 1 stop_ loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 TYMV-RNA 1 $TYMV-RNA . . . native . . . . . 4250 1 stop_ loop_ _Assembly_db_link.Author_supplied _Assembly_db_link.Database_code _Assembly_db_link.Accession_code _Assembly_db_link.Entry_mol_code _Assembly_db_link.Entry_mol_name _Assembly_db_link.Entry_experimental_method _Assembly_db_link.Entry_structure_resolution _Assembly_db_link.Entry_relation_type _Assembly_db_link.Entry_details _Assembly_db_link.Entry_ID _Assembly_db_link.Assembly_ID . PDB 3PHP . . . . . . 4250 1 stop_ loop_ _Assembly_common_name.Name _Assembly_common_name.Type _Assembly_common_name.Entry_ID _Assembly_common_name.Assembly_ID "3' hairpin of TYMV pseudoknot" system 4250 1 TYMV-RNA abbreviation 4250 1 stop_ loop_ _Assembly_bio_function.Biological_function _Assembly_bio_function.Entry_ID _Assembly_bio_function.Assembly_ID 'Involved in the nucleotide excision repair' 4250 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_TYMV-RNA _Entity.Sf_category entity _Entity.Sf_framecode TYMV-RNA _Entity.Entry_ID 4250 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name "3' hairpin of TYMV pseudoknot" _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGUUCCGAGGGUCAUCGGAA CCA ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 23 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic . _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID "3' hairpin of TYMV pseudoknot" common 4250 1 TYMV abbreviation 4250 1 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 4250 1 2 . G . 4250 1 3 . U . 4250 1 4 . U . 4250 1 5 . C . 4250 1 6 . C . 4250 1 7 . G . 4250 1 8 . A . 4250 1 9 . G . 4250 1 10 . G . 4250 1 11 . G . 4250 1 12 . U . 4250 1 13 . C . 4250 1 14 . A . 4250 1 15 . U . 4250 1 16 . C . 4250 1 17 . G . 4250 1 18 . G . 4250 1 19 . A . 4250 1 20 . A . 4250 1 21 . C . 4250 1 22 . C . 4250 1 23 . A . 4250 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 4250 1 . G 2 2 4250 1 . U 3 3 4250 1 . U 4 4 4250 1 . C 5 5 4250 1 . C 6 6 4250 1 . G 7 7 4250 1 . A 8 8 4250 1 . G 9 9 4250 1 . G 10 10 4250 1 . G 11 11 4250 1 . U 12 12 4250 1 . C 13 13 4250 1 . A 14 14 4250 1 . U 15 15 4250 1 . C 16 16 4250 1 . G 17 17 4250 1 . G 18 18 4250 1 . A 19 19 4250 1 . A 20 20 4250 1 . C 21 21 4250 1 . C 22 22 4250 1 . A 23 23 4250 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 4250 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $TYMV-RNA . 12154 virus . 'Tymovirus Turnip yellow mosaic virus' TYMV . . viruses . Tymovirus 'Turnip yellow mosaic virus' . . . . . . . . . . . . . . . . . . . . . 4250 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 4250 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $TYMV-RNA . 'enzymatic semisynthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4250 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_one _Sample.Sf_category sample _Sample.Sf_framecode sample_one _Sample.Entry_ID 4250 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 "3' hairpin of TYMV pseudoknot" . . . 1 $TYMV-RNA . . 3.5 . . mM . . . . 4250 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_one _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_one _Sample_condition_list.Entry_ID 4250 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID pH* 6.8 0.1 n/a 4250 1 temperature 295 1 K 4250 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_one _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_one _NMR_spectrometer.Entry_ID 4250 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AM _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 400 save_ save_NMR_spectrometer_two _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_two _NMR_spectrometer.Entry_ID 4250 _NMR_spectrometer.ID 2 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AMX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode spectrometer_list _NMR_spectrometer_list.Entry_ID 4250 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_one Bruker AM . 400 . . . 4250 1 2 NMR_spectrometer_two Bruker AMX . 600 . . . 4250 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 4250 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 NOESY . . . . . . . . . . . 1 $sample_one . . . 1 $sample_conditions_one . . . . . . . . . . . . . . . . . . . . . 4250 1 2 'DQF COSY' . . . . . . . . . . . 1 $sample_one . . . 1 $sample_conditions_one . . . . . . . . . . . . . . . . . . . . . 4250 1 3 '{31P-1H} HETCOR' . . . . . . . . . . . 1 $sample_one . . . 1 $sample_conditions_one . . . . . . . . . . . . . . . . . . . . . 4250 1 4 '{13C-1H} HMQC' . . . . . . . . . . . 1 $sample_one . . . 1 $sample_conditions_one . . . . . . . . . . . . . . . . . . . . . 4250 1 stop_ save_ save_NMR_spec_expt__0_1 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_1 _NMR_spec_expt.Entry_ID 4250 _NMR_spec_expt.ID 1 _NMR_spec_expt.Name NOESY _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_2 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_2 _NMR_spec_expt.Entry_ID 4250 _NMR_spec_expt.ID 2 _NMR_spec_expt.Name 'DQF COSY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_3 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_3 _NMR_spec_expt.Entry_ID 4250 _NMR_spec_expt.ID 3 _NMR_spec_expt.Name '{31P-1H} HETCOR' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_4 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_4 _NMR_spec_expt.Entry_ID 4250 _NMR_spec_expt.ID 4 _NMR_spec_expt.Name '{13C-1H} HMQC' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference_one _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference_one _Chem_shift_reference.Entry_ID 4250 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 TSP 'methyl protons' . . . . ppm 0.00 external direct . external_to_the_sample spherical parallel_to_Bo . . . . . . 4250 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_one _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_one _Assigned_chem_shift_list.Entry_ID 4250 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_one _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference_one _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID . . 1 $sample_one . 4250 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H8 H 1 8.20 0.02 . 1 . . . . . . . . 4250 1 2 . 1 1 1 1 G H1' H 1 5.95 0.02 . 1 . . . . . . . . 4250 1 3 . 1 1 1 1 G H2' H 1 4.93 0.02 . 1 . . . . . . . . 4250 1 4 . 1 1 1 1 G H3' H 1 4.71 0.02 . 1 . . . . . . . . 4250 1 5 . 1 1 1 1 G H4' H 1 4.58 0.02 . 1 . . . . . . . . 4250 1 6 . 1 1 1 1 G H1 H 1 12.18 0.02 . 1 . . . . . . . . 4250 1 7 . 1 1 2 2 G H8 H 1 7.42 0.02 . 1 . . . . . . . . 4250 1 8 . 1 1 2 2 G H1' H 1 5.83 0.02 . 1 . . . . . . . . 4250 1 9 . 1 1 2 2 G H2' H 1 4.54 0.02 . 1 . . . . . . . . 4250 1 10 . 1 1 2 2 G H3' H 1 4.18 0.02 . 1 . . . . . . . . 4250 1 11 . 1 1 2 2 G H4' H 1 4.55 0.02 . 1 . . . . . . . . 4250 1 12 . 1 1 2 2 G H1 H 1 13.24 0.02 . 1 . . . . . . . . 4250 1 13 . 1 1 3 3 U H6 H 1 7.79 0.02 . 1 . . . . . . . . 4250 1 14 . 1 1 3 3 U H5 H 1 5.13 0.02 . 1 . . . . . . . . 4250 1 15 . 1 1 3 3 U H1' H 1 5.60 0.02 . 1 . . . . . . . . 4250 1 16 . 1 1 3 3 U H2' H 1 4.53 0.02 . 1 . . . . . . . . 4250 1 17 . 1 1 3 3 U H3' H 1 4.48 0.02 . 1 . . . . . . . . 4250 1 18 . 1 1 3 3 U H4' H 1 4.11 0.02 . 1 . . . . . . . . 4250 1 19 . 1 1 3 3 U H3 H 1 14.41 0.02 . 1 . . . . . . . . 4250 1 20 . 1 1 4 4 U H6 H 1 8.00 0.02 . 1 . . . . . . . . 4250 1 21 . 1 1 4 4 U H5 H 1 5.62 0.02 . 1 . . . . . . . . 4250 1 22 . 1 1 4 4 U H1' H 1 5.67 0.02 . 1 . . . . . . . . 4250 1 23 . 1 1 4 4 U H2' H 1 4.53 0.02 . 1 . . . . . . . . 4250 1 24 . 1 1 4 4 U H3' H 1 4.49 0.02 . 1 . . . . . . . . 4250 1 25 . 1 1 4 4 U H4' H 1 4.45 0.02 . 1 . . . . . . . . 4250 1 26 . 1 1 4 4 U H3 H 1 13.89 0.02 . 1 . . . . . . . . 4250 1 27 . 1 1 5 5 C H6 H 1 7.84 0.02 . 1 . . . . . . . . 4250 1 28 . 1 1 5 5 C H5 H 1 5.67 0.02 . 1 . . . . . . . . 4250 1 29 . 1 1 5 5 C H1' H 1 5.51 0.02 . 1 . . . . . . . . 4250 1 30 . 1 1 5 5 C H2' H 1 4.31 0.02 . 1 . . . . . . . . 4250 1 31 . 1 1 5 5 C H3' H 1 4.45 0.02 . 1 . . . . . . . . 4250 1 32 . 1 1 5 5 C H4' H 1 4.10 0.02 . 1 . . . . . . . . 4250 1 33 . 1 1 5 5 C H41 H 1 8.41 0.02 . 1 . . . . . . . . 4250 1 34 . 1 1 5 5 C H42 H 1 7.00 0.02 . 1 . . . . . . . . 4250 1 35 . 1 1 6 6 C H6 H 1 7.70 0.02 . 1 . . . . . . . . 4250 1 36 . 1 1 6 6 C H5 H 1 5.46 0.02 . 1 . . . . . . . . 4250 1 37 . 1 1 6 6 C H1' H 1 5.41 0.02 . 1 . . . . . . . . 4250 1 38 . 1 1 6 6 C H2' H 1 4.50 0.02 . 1 . . . . . . . . 4250 1 39 . 1 1 6 6 C H3' H 1 4.40 0.02 . 1 . . . . . . . . 4250 1 40 . 1 1 6 6 C H4' H 1 4.37 0.02 . 1 . . . . . . . . 4250 1 41 . 1 1 6 6 C H41 H 1 8.29 0.02 . 1 . . . . . . . . 4250 1 42 . 1 1 6 6 C H42 H 1 6.74 0.02 . 1 . . . . . . . . 4250 1 43 . 1 1 7 7 G H8 H 1 7.51 0.02 . 1 . . . . . . . . 4250 1 44 . 1 1 7 7 G H1' H 1 5.65 0.02 . 1 . . . . . . . . 4250 1 45 . 1 1 7 7 G H2' H 1 4.60 0.02 . 1 . . . . . . . . 4250 1 46 . 1 1 7 7 G H3' H 1 4.47 0.02 . 1 . . . . . . . . 4250 1 47 . 1 1 7 7 G H4' H 1 4.46 0.02 . 1 . . . . . . . . 4250 1 48 . 1 1 7 7 G H1 H 1 11.89 0.02 . 1 . . . . . . . . 4250 1 49 . 1 1 8 8 A H8 H 1 7.60 0.02 . 1 . . . . . . . . 4250 1 50 . 1 1 8 8 A H2 H 1 7.64 0.02 . 1 . . . . . . . . 4250 1 51 . 1 1 8 8 A H1' H 1 5.90 0.02 . 1 . . . . . . . . 4250 1 52 . 1 1 8 8 A H2' H 1 4.63 0.02 . 1 . . . . . . . . 4250 1 53 . 1 1 8 8 A H3' H 1 4.55 0.02 . 1 . . . . . . . . 4250 1 54 . 1 1 8 8 A H4' H 1 4.48 0.02 . 1 . . . . . . . . 4250 1 55 . 1 1 9 9 G H8 H 1 7.09 0.02 . 1 . . . . . . . . 4250 1 56 . 1 1 9 9 G H1' H 1 5.23 0.02 . 1 . . . . . . . . 4250 1 57 . 1 1 9 9 G H2' H 1 4.41 0.02 . 1 . . . . . . . . 4250 1 58 . 1 1 9 9 G H3' H 1 4.38 0.02 . 1 . . . . . . . . 4250 1 59 . 1 1 9 9 G H4' H 1 4.36 0.02 . 1 . . . . . . . . 4250 1 60 . 1 1 9 9 G H1 H 1 11.15 0.02 . 1 . . . . . . . . 4250 1 61 . 1 1 9 9 G H21 H 1 6.64 0.02 . 1 . . . . . . . . 4250 1 62 . 1 1 9 9 G H22 H 1 6.64 0.02 . 1 . . . . . . . . 4250 1 63 . 1 1 10 10 G H8 H 1 7.38 0.02 . 1 . . . . . . . . 4250 1 64 . 1 1 10 10 G H1' H 1 5.22 0.02 . 1 . . . . . . . . 4250 1 65 . 1 1 10 10 G H2' H 1 4.38 0.02 . 1 . . . . . . . . 4250 1 66 . 1 1 10 10 G H3' H 1 4.50 0.02 . 1 . . . . . . . . 4250 1 67 . 1 1 10 10 G H4' H 1 4.12 0.02 . 1 . . . . . . . . 4250 1 68 . 1 1 10 10 G H1 H 1 10.59 0.02 . 1 . . . . . . . . 4250 1 69 . 1 1 11 11 G H8 H 1 7.76 0.02 . 1 . . . . . . . . 4250 1 70 . 1 1 11 11 G H1' H 1 5.65 0.02 . 1 . . . . . . . . 4250 1 71 . 1 1 11 11 G H2' H 1 4.83 0.02 . 1 . . . . . . . . 4250 1 72 . 1 1 11 11 G H3' H 1 4.66 0.02 . 1 . . . . . . . . 4250 1 73 . 1 1 11 11 G H4' H 1 4.38 0.02 . 1 . . . . . . . . 4250 1 74 . 1 1 12 12 U H6 H 1 7.78 0.02 . 1 . . . . . . . . 4250 1 75 . 1 1 12 12 U H5 H 1 5.80 0.02 . 1 . . . . . . . . 4250 1 76 . 1 1 12 12 U H1' H 1 5.92 0.02 . 1 . . . . . . . . 4250 1 77 . 1 1 12 12 U H2' H 1 4.38 0.02 . 1 . . . . . . . . 4250 1 78 . 1 1 12 12 U H3' H 1 4.61 0.02 . 1 . . . . . . . . 4250 1 79 . 1 1 13 13 C H6 H 1 7.76 0.02 . 1 . . . . . . . . 4250 1 80 . 1 1 13 13 C H5 H 1 5.99 0.02 . 1 . . . . . . . . 4250 1 81 . 1 1 13 13 C H1' H 1 5.92 0.02 . 1 . . . . . . . . 4250 1 82 . 1 1 13 13 C H2' H 1 4.41 0.02 . 1 . . . . . . . . 4250 1 83 . 1 1 13 13 C H3' H 1 4.61 0.02 . 1 . . . . . . . . 4250 1 84 . 1 1 14 14 A H8 H 1 8.40 0.02 . 1 . . . . . . . . 4250 1 85 . 1 1 14 14 A H2 H 1 8.33 0.02 . 1 . . . . . . . . 4250 1 86 . 1 1 14 14 A H1' H 1 6.17 0.02 . 1 . . . . . . . . 4250 1 87 . 1 1 14 14 A H2' H 1 4.85 0.02 . 1 . . . . . . . . 4250 1 88 . 1 1 14 14 A H3' H 1 4.80 0.02 . 1 . . . . . . . . 4250 1 89 . 1 1 14 14 A H4' H 1 4.67 0.02 . 1 . . . . . . . . 4250 1 90 . 1 1 15 15 U H6 H 1 7.96 0.02 . 1 . . . . . . . . 4250 1 91 . 1 1 15 15 U H5 H 1 5.81 0.02 . 1 . . . . . . . . 4250 1 92 . 1 1 15 15 U H1' H 1 5.35 0.02 . 1 . . . . . . . . 4250 1 93 . 1 1 15 15 U H2' H 1 4.51 0.02 . 1 . . . . . . . . 4250 1 94 . 1 1 15 15 U H3' H 1 4.05 0.02 . 1 . . . . . . . . 4250 1 95 . 1 1 15 15 U H4' H 1 4.44 0.02 . 1 . . . . . . . . 4250 1 96 . 1 1 15 15 U H3 H 1 14.15 0.02 . 1 . . . . . . . . 4250 1 97 . 1 1 16 16 C H6 H 1 7.86 0.02 . 1 . . . . . . . . 4250 1 98 . 1 1 16 16 C H5 H 1 5.70 0.02 . 1 . . . . . . . . 4250 1 99 . 1 1 16 16 C H1' H 1 5.61 0.02 . 1 . . . . . . . . 4250 1 100 . 1 1 16 16 C H2' H 1 4.56 0.02 . 1 . . . . . . . . 4250 1 101 . 1 1 16 16 C H3' H 1 4.44 0.02 . 1 . . . . . . . . 4250 1 102 . 1 1 16 16 C H4' H 1 4.46 0.02 . 1 . . . . . . . . 4250 1 103 . 1 1 16 16 C H41 H 1 8.25 0.02 . 1 . . . . . . . . 4250 1 104 . 1 1 16 16 C H42 H 1 8.25 0.02 . 1 . . . . . . . . 4250 1 105 . 1 1 17 17 G H8 H 1 7.51 0.02 . 1 . . . . . . . . 4250 1 106 . 1 1 17 17 G H1' H 1 5.67 0.02 . 1 . . . . . . . . 4250 1 107 . 1 1 17 17 G H2' H 1 4.61 0.02 . 1 . . . . . . . . 4250 1 108 . 1 1 17 17 G H3' H 1 4.53 0.02 . 1 . . . . . . . . 4250 1 109 . 1 1 17 17 G H1 H 1 12.16 0.02 . 1 . . . . . . . . 4250 1 110 . 1 1 18 18 G H8 H 1 7.17 0.02 . 1 . . . . . . . . 4250 1 111 . 1 1 18 18 G H1' H 1 5.67 0.02 . 1 . . . . . . . . 4250 1 112 . 1 1 18 18 G H2' H 1 4.56 0.02 . 1 . . . . . . . . 4250 1 113 . 1 1 18 18 G H3' H 1 4.51 0.02 . 1 . . . . . . . . 4250 1 114 . 1 1 18 18 G H4' H 1 4.47 0.02 . 1 . . . . . . . . 4250 1 115 . 1 1 18 18 G H1 H 1 12.39 0.02 . 1 . . . . . . . . 4250 1 116 . 1 1 19 19 A H8 H 1 7.68 0.02 . 1 . . . . . . . . 4250 1 117 . 1 1 19 19 A H2 H 1 7.10 0.02 . 1 . . . . . . . . 4250 1 118 . 1 1 19 19 A H1' H 1 5.88 0.02 . 1 . . . . . . . . 4250 1 119 . 1 1 19 19 A H2' H 1 4.56 0.02 . 1 . . . . . . . . 4250 1 120 . 1 1 19 19 A H3' H 1 4.66 0.02 . 1 . . . . . . . . 4250 1 121 . 1 1 19 19 A H4' H 1 4.50 0.02 . 1 . . . . . . . . 4250 1 122 . 1 1 20 20 A H8 H 1 7.82 0.02 . 1 . . . . . . . . 4250 1 123 . 1 1 20 20 A H2 H 1 7.80 0.02 . 1 . . . . . . . . 4250 1 124 . 1 1 20 20 A H1' H 1 5.92 0.02 . 1 . . . . . . . . 4250 1 125 . 1 1 20 20 A H2' H 1 4.46 0.02 . 1 . . . . . . . . 4250 1 126 . 1 1 20 20 A H3' H 1 4.59 0.02 . 1 . . . . . . . . 4250 1 127 . 1 1 20 20 A H4' H 1 4.41 0.02 . 1 . . . . . . . . 4250 1 128 . 1 1 21 21 C H6 H 1 7.47 0.02 . 1 . . . . . . . . 4250 1 129 . 1 1 21 21 C H5 H 1 5.16 0.02 . 1 . . . . . . . . 4250 1 130 . 1 1 21 21 C H1' H 1 5.39 0.02 . 1 . . . . . . . . 4250 1 131 . 1 1 21 21 C H2' H 1 4.22 0.02 . 1 . . . . . . . . 4250 1 132 . 1 1 21 21 C H3' H 1 4.34 0.02 . 1 . . . . . . . . 4250 1 133 . 1 1 21 21 C H4' H 1 4.36 0.02 . 1 . . . . . . . . 4250 1 134 . 1 1 21 21 C H41 H 1 8.40 0.02 . 1 . . . . . . . . 4250 1 135 . 1 1 21 21 C H42 H 1 8.40 0.02 . 1 . . . . . . . . 4250 1 136 . 1 1 22 22 C H6 H 1 7.60 0.02 . 1 . . . . . . . . 4250 1 137 . 1 1 22 22 C H5 H 1 5.40 0.02 . 1 . . . . . . . . 4250 1 138 . 1 1 22 22 C H1' H 1 5.49 0.02 . 1 . . . . . . . . 4250 1 139 . 1 1 22 22 C H2' H 1 4.41 0.02 . 1 . . . . . . . . 4250 1 140 . 1 1 22 22 C H3' H 1 4.38 0.02 . 1 . . . . . . . . 4250 1 141 . 1 1 22 22 C H4' H 1 4.47 0.02 . 1 . . . . . . . . 4250 1 142 . 1 1 22 22 C H41 H 1 8.21 0.02 . 1 . . . . . . . . 4250 1 143 . 1 1 22 22 C H42 H 1 8.21 0.02 . 1 . . . . . . . . 4250 1 144 . 1 1 23 23 A H8 H 1 8.03 0.02 . 1 . . . . . . . . 4250 1 145 . 1 1 23 23 A H2 H 1 7.36 0.02 . 1 . . . . . . . . 4250 1 146 . 1 1 23 23 A H1' H 1 5.98 0.02 . 1 . . . . . . . . 4250 1 147 . 1 1 23 23 A H2' H 1 4.05 0.02 . 1 . . . . . . . . 4250 1 148 . 1 1 23 23 A H3' H 1 4.30 0.02 . 1 . . . . . . . . 4250 1 149 . 1 1 23 23 A H4' H 1 4.25 0.02 . 1 . . . . . . . . 4250 1 stop_ save_